TkA01G007120 | RubberDandelionOmics

Gene overview

TkA01G007120

Reference: TK1151 Chr: Chr01 Coordinates: 1845456-1848109 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1438 bp · TkA01G007120|TK1151|cDNA

TGGTTATATTGGTGATTTTCCAATATTTTTGCTATTTCTCTAAAAAAAAAAAAATGGTCAATGCGGGTTTAACCACAAAGGGGTTTCGGGTACACCATCGTTGATCGTTCTATGACTATGGTTTGGTAAAGCACGAGTACGTTTTCCGGCGTAGCTGCCTTCCACCAGTGACCCGCCATCAAATCCCTTCCTCCATTAATGAACTCAAAGCTTGAAAACCTGTGGGAAGAAGTGAGGGAACTAAGCTTAGGAACCACTCC...

CDS

Download CDS FASTA

771 bp · TkA01G007120|TK1151|CDS

ATGAACTCAAAGCTTGAAAACCTGTGGGAAGAAGTGAGGGAACTAAGCTTAGGAACCACTCCCCAAATCGACCGCCTACACACCCCACCAACCCCACTCCAATTCCTCCGCGATTACCTCTCTCAAAACAAACCCTTCATCCTCTCCGCCTCCGCCGCCACAACCCTCCAGTGGCCCGCCACCACTCTCTGGACTTCAACATCATACCTCCTCAACGCCCTCTCTTCCTCCACCGTCTCCCTCCACCTAACCCCCACCGG...

Protein

Download Protein FASTA

256 aa · TkA01G007120|TK1151|PROTEIN

MNSKLENLWEEVRELSLGTTPQIDRLHTPPTPLQFLRDYLSQNKPFILSASAATTLQWPATTLWTSTSYLLNALSSSTVSLHLTPTGQADSLTAHPSNPDSLCFASAHVQRAPFSDAIDAIKASRKNNSGARFVAYAQQQNDCFREEYTALAGDCDSHISWATEAIGGLPEAVNLWIGNELSETSFHKDHYENLYAVVTGENTFCFFLRLMFIECIFVNTLLLNVYSEETEEFRLEVEDPVRYVPWCSVNPFGFFQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G007120`
TK1151 ID	TkA01G007120
OH-1004 ID	LXL04_005921
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.700
Protein coverage (%)	TK1151 99.219 / OH-1004 70.637 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G007120

Location Chr01:1845456-1848109 (+)

Description Similar to JMJD7: Bifunctional peptidase and (3S)-lysyl hydroxylase JMJD7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g45880`	Histone demethylase that demethylates 'Lys-27' (H3K27me) of histone H3 with a specific activity for H3K27me3 and H3K27me2, and involved in the regulation of gene expression.	Jumonji demethylases moderate precocious flowering at elevated temperature via regulation of FLC in Arabidopsis.2014 · DOI: 10.1038/ncomms6098 Abscisic acid-dependent histone demethylation during postgermination growth arrest in Arabidopsis.2019 · DOI: 10.1111/pce.13547 Histone demethylases control root elongation in response to stress-signaling hormone abscisic acid.2019 · DOI: 10.1080/15592324.2019.1604019

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005921 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0017185 peptidyl-lysine hydroxylation Biological Process

GO:0018126 protein hydroxylation Biological Process

GO:0045814 negative regulation of gene expression, epigenetic Biological Process

GO:0080022 primary root development Biological Process

GO:1900140 regulation of seedling development Biological Process

GO:1900457 regulation of brassinosteroid mediated signaling pathway Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G45880

ddi:DDB_G0292770

dme:Dmel_CG10133

hsa:100137047

mmu:433466

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.718

Rank 1 · TkA01G007120 · TK1151

Nucleus0.675

Rank 2 · TkA01G007120 · TK1151

Mitochondrion0.042

Rank 3 · TkA01G007120 · TK1151

Peroxisome0.038

Rank 4 · TkA01G007120 · TK1151

Endoplasmic reticulum0.028

Rank 5 · TkA01G007120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07725LRR_32-12 aa

PF13621Cupin_832-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G007120	`PF07725`	LRR_3	2	12	0.05	14.2
TkA01G007120	`PF13621`	Cupin_8	32	207	8.2e-35	121.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WVR4`	Arabidopsis thaliana	sp\|Q0WVR4\|JMJ32_ARATH Lysine-specific demethylase JMJ32	51.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card