LXL04_040113 | RubberDandelionOmics

Gene overview

LXL04_040113

Reference: OH-1004 Chr: JAJTUU010000308.1 Coordinates: 3270-5869 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1950 bp · LXL04_040113|LXL04_040113|OH1004|cDNA

ATGAGTGTCATAATTGGGATAGTCTTATTACTTCAAATTCAAAGAAAGGCAGTTCTTCGTTTTCAAAAAAGAAATCACAGACTATTCTTCTTCCTATATACTTCTCATGTATGTGAATATGAATCTGGCTTCCTCTTTCTTCGTAACCAATCTTCTCACTTACGATCAACATCTTCTGGAGCCCTTATTGAACGAATATATTTTTATGGAAAAATAGAGCATTTTGCAGAAGTCAGGGCTTTTCAAGCGAATTTATGGTT...

CDS

Download CDS FASTA

1950 bp · LXL04_040113|LXL04_040113|OH1004|CDS

ATGAGTGTCATAATTGGGATAGTCTTATTACTTCAAATTCAAAGAAAGGCAGTTCTTCGTTTTCAAAAAAGAAATCACAGACTATTCTTCTTCCTATATACTTCTCATGTATGTGAATATGAATCTGGCTTCCTCTTTCTTCGTAACCAATCTTCTCACTTACGATCAACATCTTCTGGAGCCCTTATTGAACGAATATATTTTTATGGAAAAATAGAGCATTTTGCAGAAGTCAGGGCTTTTCAAGCGAATTTATGGTT...

Protein

Download Protein FASTA

649 aa · LXL04_040113|LXL04_040113|OH1004|PROTEIN

MSVIIGIVLLLQIQRKAVLRFQKRNHRLFFFLYTSHVCEYESGFLFLRNQSSHLRSTSSGALIERIYFYGKIEHFAEVRAFQANLWLFKDPFMHYVRYQGKSILASKGTFLLMNKWKYYFINFWKSYFYLWSQPGRISINQLSNHSLDFLGYRSSVRLKPSMVRSQMLENAFLIENVIKKFETIVPIMPLIGSLAKSKFCNALGHPIGKAIWADFADSDIIDRFGRIYRNLSHYHSGSSKKKSLYRVKYILRLSCARTLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_040113`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_040113`
Location	JAJTUU010000308.1:3270-5869 (-)
Description	Similar to psbA: Photosystem II protein D1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_040113` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0009635 response to herbicide Biological Process GO:0009772 photosynthetic electron transport in photosystem II Biological Process GO:0009523 photosystem II Cellular Component GO:0009535 chloroplast thylakoid membrane Cellular Component GO:0005506 iron ion binding Molecular Function GO:0009055 electron transfer activity Molecular Function GO:0010242 oxygen evolving activity Molecular Function GO:0016168 chlorophyll binding Molecular Function GO:0016682 oxidoreductase activity, acting on diphenols and related substances as donors, oxygen as acceptor Molecular Function
KEGG gene cross-reference	nta:800514 sly:3950408 soe:2715607 sot:4099946 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.642

Rank 1 · LXL04_040113 · OH-1004

Mitochondrion0.203

Rank 2 · LXL04_040113 · OH-1004

Cytoplasm0.070

Rank 3 · LXL04_040113 · OH-1004

Nucleus0.067

Rank 4 · LXL04_040113 · OH-1004

Cell membrane0.038

Rank 5 · LXL04_040113 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01824.24MatK_N11-151 aa

PF01348.27Intron_maturas2179-300 aa

PF00124.25Photo_RC324-623 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_040113	`PF01824.24`	MatK_N	11	151	1.3e-61	209.8
LXL04_040113	`PF01348.27`	Intron_maturas2	179	300	2.6e-37	128.6
LXL04_040113	`PF00124.25`	Photo_RC	324	623	4.2e-93	312.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card