LXL04_039878 | RubberDandelionOmics

Gene overview

LXL04_039878

Reference: OH-1004 Chr: JAJTUU010000059.1 Coordinates: 64037-71858 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1416 bp · LXL04_039878|LXL04_039878|OH1004|cDNA

ATGGCTGGATCTTCAATTCAACGGACATCTTCTGGCTTCTCACCCTATTGTTGCTGCACAATTCGTTCAACCTACTGTTGCACCATCAACTTTCTCGCCCTACTGGTTGTTGATTCCAACACAATTGGTATTTCCAAAACACCTTCTTATTCCCAAGATTCAAAAGAGGTTATCTCTCAAACAGTAGAAAACTTAACTCCGAGTCCCGTAGAGAAACCGCCACCCACGATGTCGCAGGATGTACTTTCAAAGCCAACAGA...

CDS

Download CDS FASTA

1416 bp · LXL04_039878|LXL04_039878|OH1004|CDS

ATGGCTGGATCTTCAATTCAACGGACATCTTCTGGCTTCTCACCCTATTGTTGCTGCACAATTCGTTCAACCTACTGTTGCACCATCAACTTTCTCGCCCTACTGGTTGTTGATTCCAACACAATTGGTATTTCCAAAACACCTTCTTATTCCCAAGATTCAAAAGAGGTTATCTCTCAAACAGTAGAAAACTTAACTCCGAGTCCCGTAGAGAAACCGCCACCCACGATGTCGCAGGATGTACTTTCAAAGCCAACAGA...

Protein

Download Protein FASTA

471 aa · LXL04_039878|LXL04_039878|OH1004|PROTEIN

MAGSSIQRTSSGFSPYCCCTIRSTYCCTINFLALLVVDSNTIGISKTPSYSQDSKEVISQTVENLTPSPVEKPPPTMSQDVLSKPTDLKWRFDEVFDVDDYSASSSSNKTDYLCEELIVEIFTRLPPKSLLRFRSLSKLLCSCISSPIFICMHTIRSPTKIILSHLKWKNKNKEARYFQTLHGEEELPLCLCPKREYNGIKTKAPLFRCNIHIGIIGSCNGIFCVISESENRLSLWNPSIRREVSVPELPRKPNPDTRKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039878`
TK1151 ID	TkA06G258170
OH-1004 ID	LXL04_039878
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	54.400
Protein coverage (%)	TK1151 96.919 / OH-1004 76.645 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039878

Location JAJTUU010000059.1:64037-71858 (+)

Description Similar to At3g06240: F-box/kelch-repeat protein At3g06240

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g06240`	F-box/kelch-repeat protein At3g06240.	No verified direct reference in this release
`At3g16210`	Putative F-box protein At3g16210.	No verified direct reference in this release
`At5g62660`	Putative F-box protein At5g62660.	No verified direct reference in this release
`At4g09190`	Putative F-box protein At4g09190.	No verified direct reference in this release
`At3g10240`	Putative F-box protein At3g10240.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039878 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT3G06240

ath:AT3G10240

ath:AT3G16210

ath:AT4G09190

ath:AT5G62660

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.495

Rank 1 · LXL04_039878 · OH-1004

Nucleus0.455

Rank 2 · LXL04_039878 · OH-1004

Cell membrane0.131

Rank 3 · LXL04_039878 · OH-1004

Endoplasmic reticulum0.077

Rank 4 · LXL04_039878 · OH-1004

Mitochondrion0.035

Rank 5 · LXL04_039878 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box113-149 aa

PF07734.19FBA_1208-386 aa

PF08268.18FBA_3212-386 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039878	`PF00646.39`	F-box	113	149	5e-07	30.1
LXL04_039878	`PF07734.19`	FBA_1	208	386	8.1e-13	48.8
LXL04_039878	`PF08268.18`	FBA_3	212	386	2.7e-17	63.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GXC7`	Arabidopsis thaliana	F-box/kelch-repeat protein At3g06240	29.855%	Swiss-Prot	weak database homology
`Q9LU24`	Arabidopsis thaliana	Putative F-box protein At3g16210	27.517%	Swiss-Prot	weak database homology
`Q9LV12`	Arabidopsis thaliana	Putative F-box protein At5g62660	26.441%	Swiss-Prot	weak database homology
`Q9M0Q9`	Arabidopsis thaliana	Putative F-box protein At4g09190	26.073%	Swiss-Prot	weak database homology
`Q9SS35`	Arabidopsis thaliana	Putative F-box protein At3g10240	23.684%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card