LXL04_039751 | RubberDandelionOmics

Gene overview

LXL04_039751

Reference: OH-1004 Chr: JAJTUU010000035.1 Coordinates: 96780-98809 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1119 bp · LXL04_039751|LXL04_039751|OH1004|cDNA

atgGGTACCAATTTCACTTTCACTTTCACATCCATCTTCTTCTCCCAAATCTCCATGAGCAACACTCGGTTTCTGGGTTTATACATCACCATATGCGTATTAGCTTTCATCGTCTCAAAGATCACCATAGCTGTCCTCTGCTATCGCCGATGGCAGAAAAAACAGTTCGTCATTCAAGACACCTTCTCTGGTGGAAAGCTGGTACTGTTCAGATCACCGAAGATCAAAACCGTAAAATCGAATGTGTTTTTGAAGAAGAC...

CDS

Download CDS FASTA

1119 bp · LXL04_039751|LXL04_039751|OH1004|CDS

ATGGGTACCAATTTCACTTTCACTTTCACATCCATCTTCTTCTCCCAAATCTCCATGAGCAACACTCGGTTTCTGGGTTTATACATCACCATATGCGTATTAGCTTTCATCGTCTCAAAGATCACCATAGCTGTCCTCTGCTATCGCCGATGGCAGAAAAAACAGTTCGTCATTCAAGACACCTTCTCTGGTGGAAAGCTGGTACTGTTCAGATCACCGAAGATCAAAACCGTAAAATCGAATGTGTTTTTGAAGAAGAC...

Protein

Download Protein FASTA

372 aa · LXL04_039751|LXL04_039751|OH1004|PROTEIN

MGTNFTFTFTSIFFSQISMSNTRFLGLYITICVLAFIVSKITIAVLCYRRWQKKQFVIQDTFSGGKLVLFRSPKIKTVKSNVFLKKTMKLTNKDQIGSGGYGMVYKVTIDDSTSFAVKKLRKESSEHDRGFERELEAMGDIKHRNIVTLHGYYTAPNFNLLIYELMPNGSLDVVLHGRTMEKVLDWDTRYKIAMGAARGISYLHHDCIPHIIHRDIKSSNILLDVNMEARVSDFGLATLMDQDKTHVSTLVAGTFGYLAP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039751`
TK1151 ID	TkA04G354020
OH-1004 ID	LXL04_039751
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 88.043 / OH-1004 87.097 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039751

Location JAJTUU010000035.1:96780-98809 (-)

Description Similar to At1g78530: Receptor-like serine/threonine-protein kinase At1g78530

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78530`	Receptor-like serine/threonine-protein kinase At1g78530.	No verified direct reference in this release
`At1g31420`	Involved in the signaling pathway that regulates cell wall function, including cellulose biosynthesis, likely via an 1- aminocyclopropane-1-carboxylic acid (ACC)-mediated signal (a precursor of ethylene).	Two leucine-rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.2008 · DOI: 10.1105/tpc.108.063354
`At2g35620`	Involved in the signaling pathway that regulates cell wall function, including cellulose biosynthesis, likely via an 1- aminocyclopropane-1-carboxylic acid (ACC)-mediated signal (a precursor of ethylene).	Two leucine-rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.2008 · DOI: 10.1105/tpc.108.063354
`At2g01950`	Receptor with a serine/threonine-protein kinase activity, which may transduce extracellular spatial and temporal signals into downstream cell differentiation responses in provascular and procambial cells.	VH1/BRL2 receptor-like kinase interacts with vascular-specific adaptor proteins VIT and VIK to influence leaf venation.2009 · DOI: 10.1111/j.1365-313x.2008.03742.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0293500`	May be involved in brassenosteroid (BR) perception in roots.	The role of OsBRI1 and its homologous genes, OsBRL1 and OsBRL3, in rice.2006 · DOI: 10.1104/pp.105.072330

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039751 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009664 plant-type cell wall organization Biological Process

GO:0009729 detection of brassinosteroid stimulus Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010192 mucilage biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G31420

ath:AT1G78530

ath:AT2G01950

ath:AT2G35620

dosa:Os09g0293500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.759

Rank 1 · LXL04_039751 · OH-1004

Cytoplasm0.134

Rank 2 · LXL04_039751 · OH-1004

Nucleus0.095

Rank 3 · LXL04_039751 · OH-1004

Endoplasmic reticulum0.094

Rank 4 · LXL04_039751 · OH-1004

Golgi apparatus0.032

Rank 5 · LXL04_039751 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714.24PK_Tyr_Ser-Thr91-294 aa

PF00069.32Pkinase92-293 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039751	`PF07714.24`	PK_Tyr_Ser-Thr	91	294	2.9e-43	148.8
LXL04_039751	`PF00069.32`	Pkinase	92	293	7.6e-46	157.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SYM9`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase At1g78530	71.104%	Swiss-Prot	strong database homology
`C0LGF4`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase FEI 1	47.368%	Swiss-Prot	moderate database homology
`C0LGL9`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase FEI 2	48.123%	Swiss-Prot	moderate database homology
`Q9ZPS9`	Arabidopsis thaliana	Serine/threonine-protein kinase BRI1-like 2	48.905%	Swiss-Prot	moderate database homology
`Q69JN6`	Oryza sativa subsp. japonica	Brassinosteroid LRR receptor kinase BRL1	51.852%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card