LXL04_039338 | RubberDandelionOmics

Gene overview

LXL04_039338

Reference: OH-1004 Chr: JAJTUU010000010.1 Coordinates: 3557197-3561556 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1239 bp · LXL04_039338|LXL04_039338|OH1004|cDNA

ATGGAGGAGAATTCCGGTAATGGTGGTGCTACCGATCAGATTAGTGATCGGAAGATGAATTACACGGAGGACGGGTGTCTTTCCGCCGTCGATGTGGCTGATACTCGCTCGTGGAGACTGGATATCAACAGTTTCCGGCTGCCGGAAAGCTCCGTTGAGGATAATCAGTCTTCCGCTCTCCGCCGCGTGCTAATTCCTACTCCAAGAACAAAGAGAAAAATTAAAGCATATTATAAGAAGCAAGAAAGCCTCTTTGAAGG...

CDS

Download CDS FASTA

1239 bp · LXL04_039338|LXL04_039338|OH1004|CDS

ATGGAGGAGAATTCCGGTAATGGTGGTGCTACCGATCAGATTAGTGATCGGAAGATGAATTACACGGAGGACGGGTGTCTTTCCGCCGTCGATGTGGCTGATACTCGCTCGTGGAGACTGGATATCAACAGTTTCCGGCTGCCGGAAAGCTCCGTTGAGGATAATCAGTCTTCCGCTCTCCGCCGCGTGCTAATTCCTACTCCAAGAACAAAGAGAAAAATTAAAGCATATTATAAGAAGCAAGAAAGCCTCTTTGAAGG...

Protein

Download Protein FASTA

412 aa · LXL04_039338|LXL04_039338|OH1004|PROTEIN

MEENSGNGGATDQISDRKMNYTEDGCLSAVDVADTRSWRLDINSFRLPESSVEDNQSSALRRVLIPTPRTKRKIKAYYKKQESLFEGFNEMEIINKSGSLPGALTEDEMENLAKNERMAIYVSNVANLILFVAKLYASIESRSLAVIASTLDSFLDLLSGFILWFTSNAMRNPNSYRYPIGKNRMQPVGIIVFASVMATLGFQILLESARELLAKTHPSKNHDNEEWVIGIMVSVTIVKFFLMIYCRRFENAIVRAYAQD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039338`
TK1151 ID	TkA04G230860
OH-1004 ID	LXL04_039338
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 98.544 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039338

Location JAJTUU010000010.1:3557197-3561556 (+)

Description Similar to MTP10: Metal tolerance protein 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16310`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`At1g79520`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`At2g39450`	Cation/proton antiporter involved in endogenous manganese tolerance probably through vesicular trafficking and exocytosis.	A secretory pathway-localized cation diffusion facilitator confers plant manganese tolerance.2007 · DOI: 10.1073/pnas.0609507104 A role for the AtMTP11 gene of Arabidopsis in manganese transport and tolerance.2007 · DOI: 10.1111/j.1365-313x.2007.03138.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0130000`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`Os01g0837800`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039338 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010042 response to manganese ion Biological Process

GO:0030026 intracellular manganese ion homeostasis Biological Process

GO:0046688 response to copper ion Biological Process

GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process

GO:2000031 regulation of salicylic acid mediated signaling pathway Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005770 late endosome Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G16310

ath:AT1G79520

ath:AT2G39450

dosa:Os01g0130000

dosa:Os01g0837800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.313

Rank 1 · LXL04_039338 · OH-1004

Lysosome / Vacuole0.255

Rank 2 · LXL04_039338 · OH-1004

Cell membrane0.250

Rank 3 · LXL04_039338 · OH-1004

Golgi apparatus0.243

Rank 4 · LXL04_039338 · OH-1004

Endoplasmic reticulum0.194

Rank 5 · LXL04_039338 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01545.27Cation_efflux121-313 aa

PF16916.12ZT_dimer323-393 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039338	`PF01545.27`	Cation_efflux	121	313	3.6e-36	125.5
LXL04_039338	`PF16916.12`	ZT_dimer	323	393	3.5e-08	34.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WU02`	Arabidopsis thaliana	Metal tolerance protein 10	70.845%	Swiss-Prot	strong database homology
`Q9SAJ7`	Arabidopsis thaliana	Metal tolerance protein 9	69.211%	Swiss-Prot	strong database homology
`O80632`	Arabidopsis thaliana	Metal tolerance protein 11	60.163%	Swiss-Prot	strong database homology
`Q9LDU0`	Oryza sativa subsp. japonica	Metal tolerance protein 7	65.323%	Swiss-Prot	strong database homology
`Q5NA18`	Oryza sativa subsp. japonica	Metal tolerance protein 5	60.215%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card