LXL04_039309 | RubberDandelionOmics

Gene overview

LXL04_039309

Reference: OH-1004 Chr: JAJTUU010000010.1 Coordinates: 1850421-1851894 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

594 bp · LXL04_039309|LXL04_039309|OH1004|cDNA

ATGATACCTAAGGGAAACGGTGTTCtgaatcatcatcatcatcagatgaAGAAGGGTAACTTCACTCACGGGAAACGAAGGATGAATAACCGAACCAACCTAGCACAACGAGAAGATGTGATCAGGAGAACAGTTCACGTCTCTGACATCAATCAACAGGTTGTGGATTGCCGTATATGTGGCGACCCTAATTCTGGTCTTCGTTTTGCCTTTATCGAGTTTACTAACGAGGAAGGGGCAAGAAACGCATTGAGTCTTGC...

CDS

Download CDS FASTA

594 bp · LXL04_039309|LXL04_039309|OH1004|CDS

ATGATACCTAAGGGAAACGGTGTTCTGAATCATCATCATCATCAGATGAAGAAGGGTAACTTCACTCACGGGAAACGAAGGATGAATAACCGAACCAACCTAGCACAACGAGAAGATGTGATCAGGAGAACAGTTCACGTCTCTGACATCAATCAACAGGTTGTGGATTGCCGTATATGTGGCGACCCTAATTCTGGTCTTCGTTTTGCCTTTATCGAGTTTACTAACGAGGAAGGGGCAAGAAACGCATTGAGTCTTGC...

Protein

Download Protein FASTA

197 aa · LXL04_039309|LXL04_039309|OH1004|PROTEIN

MIPKGNGVLNHHHHQMKKGNFTHGKRRMNNRTNLAQREDVIRRTVHVSDINQQVVDCRICGDPNSGLRFAFIEFTNEEGARNALSLAGTMLGYYPVRVLPSKTAIEPVNPTFLPRFEDEREMCSRTIYCTSIDKKVTQADVKLFFESFCGEVCLPFEIARRVSSFDSYCICMEFVMAESAITALNCSGALLGSLPIR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039309`
TK1151 ID	TkA04G239340
OH-1004 ID	LXL04_039309
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 74.850 / OH-1004 63.452 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039309

Location JAJTUU010000010.1:1850421-1851894 (-)

Description Similar to CID11: Polyadenylate-binding protein-interacting protein 11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32790`	Polyadenylate-binding protein-interacting protein 11.	No verified direct reference in this release
`At4g10610`	Binds nucleotic acids in vitro.	A new Arabidopsis nucleic-acid-binding protein gene is highly expressed in dividing cells during development.1997 · DOI: 10.1023/a:1005834402536
`At3g49390`	Polyadenylate-binding protein-interacting protein 10.	No verified direct reference in this release
`At3g14450`	Polyadenylate-binding protein-interacting protein 9.	No verified direct reference in this release
`At1g53650`	Polyadenylate-binding protein-interacting protein 8.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039309 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G32790

ath:AT3G14450

ath:AT3G49390

ath:AT4G10610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.528

Rank 1 · LXL04_039309 · OH-1004

Cytoplasm0.503

Rank 2 · LXL04_039309 · OH-1004

Cell membrane0.048

Rank 3 · LXL04_039309 · OH-1004

Endoplasmic reticulum0.033

Rank 4 · LXL04_039309 · OH-1004

Mitochondrion0.033

Rank 5 · LXL04_039309 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_153-92 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039309	`PF00076.29`	RRM_1	53	92	5.6e-08	33.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LPI5`	Arabidopsis thaliana	Polyadenylate-binding protein-interacting protein 11	67.164%	Swiss-Prot	strong database homology
`Q9S7N9`	Arabidopsis thaliana	Polyadenylate-binding protein-interacting protein 12	62.673%	Swiss-Prot	strong database homology
`Q9SG10`	Arabidopsis thaliana	Polyadenylate-binding protein-interacting protein 10	60.784%	Swiss-Prot	strong database homology
`Q9LRR6`	Arabidopsis thaliana	Polyadenylate-binding protein-interacting protein 9	60.714%	Swiss-Prot	strong database homology
`Q9C8M0`	Arabidopsis thaliana	Polyadenylate-binding protein-interacting protein 8	62.903%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card