LXL04_039192 | RubberDandelionOmics

Gene overview

LXL04_039192

Reference: OH-1004 Chr: Chr09 Coordinates: 62010351-62013139 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1602 bp · LXL04_039192|LXL04_039192|OH1004|cDNA

atgtcaaaatcctCATCACAAGTAGCCATGAAAGACGTGGTACACAAGATACAACTATGTCTGTTAGAAGGTATCAAGTCGGAAACCCAATTATTCGTAGCTGGATCTTTGCTCTCTAAGTCAGATTATCACGACGTCGTCACCGAAAGATCAATCGCTCAAATGTGTGGCTACCCACTTTGCCCCAACTCATTACCTTCTTCGGGAGAAGCTGCAAATAAGGGCAGATATCATATTTCCTTGAAAGAGCACAAGGTTTA...

CDS

Download CDS FASTA

1602 bp · LXL04_039192|LXL04_039192|OH1004|CDS

ATGTCAAAATCCTCATCACAAGTAGCCATGAAAGACGTGGTACACAAGATACAACTATGTCTGTTAGAAGGTATCAAGTCGGAAACCCAATTATTCGTAGCTGGATCTTTGCTCTCTAAGTCAGATTATCACGACGTCGTCACCGAAAGATCAATCGCTCAAATGTGTGGCTACCCACTTTGCCCCAACTCATTACCTTCTTCGGGAGAAGCTGCAAATAAGGGCAGATATCATATTTCCTTGAAAGAGCACAAGGTTTA...

Protein

Download Protein FASTA

533 aa · LXL04_039192|LXL04_039192|OH1004|PROTEIN

MSKSSSQVAMKDVVHKIQLCLLEGIKSETQLFVAGSLLSKSDYHDVVTERSIAQMCGYPLCPNSLPSSGEAANKGRYHISLKEHKVYDLSETRMYCSTKCVVDSGAYAESLEDERSLVLDTAKIDKVARLFEGLNVKAEEGLGDSGDFGLRNLSIKEKEDGGVGGGIVSLEEWIGPSNAIEGFTPQHDRKQKNRPGRKLKDEKLKREEERIFGEMDFMSSIITQEDGHSIGKEKNTRKSKSKNKERLKKAGNEGEIESRK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039192`
TK1151 ID	TkA04G514600
OH-1004 ID	LXL04_039192
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.800
Protein coverage (%)	TK1151 94.989 / OH-1004 81.801 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039192

Location Chr09:62010351-62013139 (-)

Description Similar to At5g26760: Putative RNA polymerase II subunit B1 CTD phosphatase RPAP2 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26760`	Putative RNA polymerase II subunit B1 C-terminal domain (CTD) phosphatase involved in RNA polymerase II transcription regulation.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2Y040`	Putative RNA polymerase II subunit B1 C-terminal domain (CTD) phosphatase involved in RNA polymerase II transcription regulation.	No verified direct reference in this release
`Os05g0134300`	Putative RNA polymerase II subunit B1 C-terminal domain (CTD) phosphatase involved in RNA polymerase II transcription regulation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039192 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0030154 cell differentiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0008420 RNA polymerase II CTD heptapeptide repeat phosphatase activity Molecular Function

GO:0043175 RNA polymerase core enzyme binding Molecular Function

KEGG gene cross-reference

ath:AT5G26760

dosa:Os05g0134300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.719

Rank 1 · LXL04_039192 · OH-1004

Cytoplasm0.267

Rank 2 · LXL04_039192 · OH-1004

Cell membrane0.067

Rank 3 · LXL04_039192 · OH-1004

Endoplasmic reticulum0.046

Rank 4 · LXL04_039192 · OH-1004

Golgi apparatus0.037

Rank 5 · LXL04_039192 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04181.19RPAP2_Rtr137-111 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039192	`PF04181.19`	RPAP2_Rtr1	37	111	1.5e-23	83.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K1B1`	Arabidopsis thaliana	Putative RNA polymerase II subunit B1 CTD phosphatase RPAP2 homolog	53.110%	Swiss-Prot	weak database homology
`A2Y040`	Oryza sativa subsp. indica	Putative RNA polymerase II subunit B1 CTD phosphatase RPAP2 homolog	46.610%	Swiss-Prot	weak database homology
`Q6AVZ9`	Oryza sativa subsp. japonica	Putative RNA polymerase II subunit B1 CTD phosphatase RPAP2 homolog	46.610%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card