LXL04_039091 | RubberDandelionOmics

Gene overview

LXL04_039091

Reference: OH-1004 Chr: Chr09 Coordinates: 59112866-59115106 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1035 bp · LXL04_039091|LXL04_039091|OH1004|cDNA

ATGTCGAGCAAGACTTCAACGAGGGAGATTGATCCGTTACTGAAGGATCTCGATGAGAAGAAACTGAGCTTTCGCCGGAACGTGGTGTCACTCGCCGCCGAGCTCAAGGATGTTCGTAGCCGTCTTTCATCCCAAGAAGAATCGTTTGCTAAAGAATCTTCAACCAGACAGGTATGCGTTCTTGCGTTCTTGGTTGAAGCAGAAACAAGAGCTAGAAACATGGAACACGAGATTTGTCGATTGCAGAAGAGTTTAGATGA...

CDS

Download CDS FASTA

1035 bp · LXL04_039091|LXL04_039091|OH1004|CDS

ATGTCGAGCAAGACTTCAACGAGGGAGATTGATCCGTTACTGAAGGATCTCGATGAGAAGAAACTGAGCTTTCGCCGGAACGTGGTGTCACTCGCCGCCGAGCTCAAGGATGTTCGTAGCCGTCTTTCATCCCAAGAAGAATCGTTTGCTAAAGAATCTTCAACCAGACAGGTATGCGTTCTTGCGTTCTTGGTTGAAGCAGAAACAAGAGCTAGAAACATGGAACACGAGATTTGTCGATTGCAGAAGAGTTTAGATGA...

Protein

Download Protein FASTA

344 aa · LXL04_039091|LXL04_039091|OH1004|PROTEIN

MSSKTSTREIDPLLKDLDEKKLSFRRNVVSLAAELKDVRSRLSSQEESFAKESSTRQVCVLAFLVEAETRARNMEHEICRLQKSLDERNLQLKASSFDAEKYQRELDHLTSQLSSTKATADASAISAKSAQMQCEVLLKELDLKNRSLKEHEARVNHLAHQLDLLQKDLESRESSQKQLKDEVMRVEHDIMEALSKAGENNDCELRKILDEVSPRNLDKMMKLLSAKDEEITKLRDEVRVMSAHWKLKTRDLESQLEKHR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039091`
TK1151 ID	TkA04G503690
OH-1004 ID	LXL04_039091
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039091

Location Chr09:59112866-59115106 (-)

Description Similar to NEAP2: Nuclear envelope-associated protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26770`	Nuclear envelope-associated protein 2.	No verified direct reference in this release
`At3g05830`	Nuclear envelope-associated protein 1.	No verified direct reference in this release
`At1g09470`	Nuclear envelope-associated protein 3.	No verified direct reference in this release
`At1g09483`	Putative nuclear envelope-associated protein 4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039091 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005635 nuclear envelope Cellular Component

GO:0005637 nuclear inner membrane Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G09470

ath:AT1G09483

ath:AT3G05830

ath:AT5G26770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.339

Rank 1 · LXL04_039091 · OH-1004

Nucleus0.277

Rank 2 · LXL04_039091 · OH-1004

Cell membrane0.136

Rank 3 · LXL04_039091 · OH-1004

Endoplasmic reticulum0.113

Rank 4 · LXL04_039091 · OH-1004

Golgi apparatus0.090

Rank 5 · LXL04_039091 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28496.1NEAP242-344 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039091	`PF28496.1`	NEAP	242	344	2.3e-47	160.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K1B4`	Arabidopsis thaliana	Nuclear envelope-associated protein 2	62.388%	Swiss-Prot	strong database homology
`Q9M9L3`	Arabidopsis thaliana	Nuclear envelope-associated protein 1	57.267%	Swiss-Prot	strong database homology
`Q4PT37`	Arabidopsis thaliana	Nuclear envelope-associated protein 3	53.779%	Swiss-Prot	strong database homology
`F4I0Z6`	Arabidopsis thaliana	Putative nuclear envelope-associated protein 4	60.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card