LXL04_039067 | RubberDandelionOmics

Gene overview

LXL04_039067

Reference: OH-1004 Chr: Chr09 Coordinates: 58406237-58409611 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1626 bp · LXL04_039067|LXL04_039067|OH1004|cDNA

ATGTCAGTATGTCACCTAATGAAAACTTCCTTTAAGCGGTCTAAACCCCAGTTAAACGGGGGTTTCTCGATTTGTTACGGGATTCAAAGCAAACGCGAGCAAAGCAATACGAATATGGCGCCAAAGTCGAGCAAGAATCGTTCACCACCGTCGGATCCTGATGGTATCTTCTCTGGTATGGTCGTCTTCCTTGTCGATACTGACGTACAGAGACGTCGTTTGGAGATATGGAAGCAAAAGCTGGTGCAGATGGGAGCAAT...

CDS

Download CDS FASTA

1626 bp · LXL04_039067|LXL04_039067|OH1004|CDS

ATGTCAGTATGTCACCTAATGAAAACTTCCTTTAAGCGGTCTAAACCCCAGTTAAACGGGGGTTTCTCGATTTGTTACGGGATTCAAAGCAAACGCGAGCAAAGCAATACGAATATGGCGCCAAAGTCGAGCAAGAATCGTTCACCACCGTCGGATCCTGATGGTATCTTCTCTGGTATGGTCGTCTTCCTTGTCGATACTGACGTACAGAGACGTCGTTTGGAGATATGGAAGCAAAAGCTGGTGCAGATGGGAGCAAT...

Protein

Download Protein FASTA

541 aa · LXL04_039067|LXL04_039067|OH1004|PROTEIN

MSVCHLMKTSFKRSKPQLNGGFSICYGIQSKREQSNTNMAPKSSKNRSPPSDPDGIFSGMVVFLVDTDVQRRRLEIWKQKLVQMGAILEEENLSRNVTHVFAINLESLCNKFEQKLLQRFKGTILLYQWLEETLRLGKKVNEESYTIHFDSPKKTGNENHEVKESNEDHLHLHKKLKSSPNNSETSSPEMKDKSLDQKVNAPDPSLPYHPPDLNRNITEIFGKLINIYRALGDDRRSFSYYKAVPVIERLPFKIESVDQV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039067`
TK1151 ID	TkA04G500870
OH-1004 ID	LXL04_039067
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 93.716 / OH-1004 63.401 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039067

Location Chr09:58406237-58409611 (+)

Description Similar to POLL: DNA polymerase lambda

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g10520`	Repair polymerase involved in base excision repair (BER) and responsible for repair of lesions that give rise to abasic (AP) sites in DNA.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0237200`	Repair polymerase involved in base excision repair (BER) and responsible for repair of lesions that give rise to abasic (AP) sites in DNA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039067 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006260 DNA replication Biological Process

GO:0006287 base-excision repair, gap-filling Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0010224 response to UV-B Biological Process

GO:0071897 DNA biosynthetic process Biological Process

GO:0097510 base-excision repair, AP site formation via deaminated base removal Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0035861 site of double-strand break Cellular Component

KEGG gene cross-reference

ath:AT1G10520

dosa:Os06g0237200

hsa:27343

rno:361767

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.831

Rank 1 · LXL04_039067 · OH-1004

Cytoplasm0.209

Rank 2 · LXL04_039067 · OH-1004

Mitochondrion0.063

Rank 3 · LXL04_039067 · OH-1004

Cell membrane0.028

Rank 4 · LXL04_039067 · OH-1004

Endoplasmic reticulum0.016

Rank 5 · LXL04_039067 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14716.14HHH_8214-283 aa

PF10391.16DNA_pol_lambd_f300-347 aa

PF14792.13DNA_pol_B_palm349-463 aa

PF14791.12DNA_pol_B_thumb470-540 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039067	`PF14716.14`	HHH_8	214	283	1.5e-13	51.6
LXL04_039067	`PF10391.16`	DNA_pol_lambd_f	300	347	2.7e-19	69.5
LXL04_039067	`PF14792.13`	DNA_pol_B_palm	349	463	3.7e-28	98.7
LXL04_039067	`PF14791.12`	DNA_pol_B_thumb	470	540	2.5e-19	69.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNY4`	Arabidopsis thaliana	DNA polymerase lambda	63.962%	Swiss-Prot	strong database homology
`Q67VC8`	Oryza sativa subsp. japonica	DNA polymerase lambda	58.912%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card