LXL04_038995 | RubberDandelionOmics

Gene overview

LXL04_038995

Reference: OH-1004 Chr: Chr09 Coordinates: 55782709-55793679 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1965 bp · LXL04_038995|LXL04_038995|OH1004|cDNA

ATGGGGGAGGAGACATCAAAGACGAGCTACAAATTACTTAGTGGGCTTAGCTTTAAGCCCAATGGTCAAAAGGGTGGCTTCAAAGCTTCTGGTTTCATCTTTGGTTTGGTGGCATTGGAGAACATGGGATTCATATCAAATGTACTGATATTGTTCTCCTACTTCATGAAAGATTTGAGTTTCAACATCCCTGGGGCCGCAAACACAGTCACTAATTTTATGGGCTCGACGTTTCTACTATCAATTATTGGTGCTTTTAT...

CDS

Download CDS FASTA

1965 bp · LXL04_038995|LXL04_038995|OH1004|CDS

ATGGGGGAGGAGACATCAAAGACGAGCTACAAATTACTTAGTGGGCTTAGCTTTAAGCCCAATGGTCAAAAGGGTGGCTTCAAAGCTTCTGGTTTCATCTTTGGTTTGGTGGCATTGGAGAACATGGGATTCATATCAAATGTACTGATATTGTTCTCCTACTTCATGAAAGATTTGAGTTTCAACATCCCTGGGGCCGCAAACACAGTCACTAATTTTATGGGCTCGACGTTTCTACTATCAATTATTGGTGCTTTTAT...

Protein

Download Protein FASTA

654 aa · LXL04_038995|LXL04_038995|OH1004|PROTEIN

MGEETSKTSYKLLSGLSFKPNGQKGGFKASGFIFGLVALENMGFISNVLILFSYFMKDLSFNIPGAANTVTNFMGSTFLLSIIGAFISDTYISRFHTCLMFGVIEIVAFVIMTIQAHDTGLHPKPCGGKASCMEGGIGFMFYTSLALLALGSGGVRGALAPFGADQFDITKPKGLTAQGSYFNWLLLSTTLGATVGVTGFIYVSTNHGWWWGFLLATISSSLGYTLFLIGKPFYRIQAPKDSPLLRITRVLIQISTADVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038995`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038995

Location Chr09:55782709-55793679 (-)

Description Similar to NPF4.6: Protein NRT1/ PTR FAMILY 4.6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69850`	Low-affinity proton-dependent nitrate transporter.	Identification of an abscisic acid transporter by functional screening using the receptor complex as a sensor.2012 · DOI: 10.1073/pnas.1203567109 Nitrate does not compete with abscisic acid as a substrate of AtNPF4.6/NRT1.2/AIT1 in Arabidopsis.2013 · DOI: 10.4161/psb.26624
`At1g27040`	Involved in abscisic acid transport.	No verified direct reference in this release
`At1g59740`	Protein NRT1/ PTR FAMILY 4.3.	No verified direct reference in this release
`At5g62730`	Protein NRT1/ PTR FAMILY 4.7.	No verified direct reference in this release
`At5g01180`	Peptide transporter.	AtPTR1 and AtPTR5 transport dipeptides in planta.2008 · DOI: 10.1104/pp.108.123844

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038995 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006857 oligopeptide transport Biological Process

GO:0009624 response to nematode Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0015031 protein transport Biological Process

GO:0042128 nitrate assimilation Biological Process

GO:0042938 dipeptide transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0080168 abscisic acid transport Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G27040

ath:AT1G59740

ath:AT1G69850

ath:AT5G01180

ath:AT5G62730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.789

Rank 1 · LXL04_038995 · OH-1004

Endoplasmic reticulum0.078

Rank 2 · LXL04_038995 · OH-1004

Cytoplasm0.071

Rank 3 · LXL04_038995 · OH-1004

Lysosome / Vacuole0.059

Rank 4 · LXL04_038995 · OH-1004

Mitochondrion0.029

Rank 5 · LXL04_038995 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00854.28PTR295-535 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038995	`PF00854.28`	PTR2	95	535	2.9e-71	241.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H157`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 4.6	40.917%	Swiss-Prot	moderate database homology
`Q8VYE4`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 4.5	41.385%	Swiss-Prot	moderate database homology
`Q93VV5`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 4.3	39.060%	Swiss-Prot	moderate database homology
`Q9FM20`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 4.7	36.731%	Swiss-Prot	moderate database homology
`Q9LFB8`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 8.2	36.204%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card