RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_038946
Reference: OH-1004 Chr: Chr09 Coordinates: 54155688-54158543 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2856 bp · LXL04_038946|LXL04_038946|OH1004|cDNA

ATGGACATTGTCTCAAGTGGGATAACAGCTATTTCCTTGCTATTGTCACCTCTTGAGAGGTTTCTCTTCTACTCAAGAAATTTTGAAAAACGAGCAAGGACATTGCTCTGTGAAATGGAAGAGCTAACTAGTAAAGAAAATGATATAAGAGCAGAAATAAGTATAGGTTTAGTGAACCAAAGAAAGAAGCTCAGAACTGAGACACAATTGTGGCTTAAAAACGTTGAAAACCTCATACATGAGGTTAAGCGGATGGAAAC...

CDS

Download CDS FASTA

2856 bp · LXL04_038946|LXL04_038946|OH1004|CDS

ATGGACATTGTCTCAAGTGGGATAACAGCTATTTCCTTGCTATTGTCACCTCTTGAGAGGTTTCTCTTCTACTCAAGAAATTTTGAAAAACGAGCAAGGACATTGCTCTGTGAAATGGAAGAGCTAACTAGTAAAGAAAATGATATAAGAGCAGAAATAAGTATAGGTTTAGTGAACCAAAGAAAGAAGCTCAGAACTGAGACACAATTGTGGCTTAAAAACGTTGAAAACCTCATACATGAGGTTAAGCGGATGGAAAC...

Protein

Download Protein FASTA

951 aa · LXL04_038946|LXL04_038946|OH1004|PROTEIN

MDIVSSGITAISLLLSPLERFLFYSRNFEKRARTLLCEMEELTSKENDIRAEISIGLVNQRKKLRTETQLWLKNVENLIHEVKRMETKITRNKRCMKGCFPNYRSRYRLNKMMIKRINEMRELHAKGVFSNGLFVDSFPNTRRILPTSGVVGDKTFQRVSKVIWELLTDANTSRIGIYGMGGVGKTSVMMHIYNKLIDCKDFDRVIWVNVSKTLNVEKLQIDIANATNLELSEEENVIWRSTRLLEHLQGKKFVLILDDM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_038946
TK1151 IDTkA04G486500
OH-1004 IDLXL04_038946
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.400
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_038946
LocationChr09:54155688-54158543 (-)
DescriptionSimilar to At4g27190: Disease resistance protein At4g27190
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g27190 Disease resistance protein. No verified direct reference in this release
At4g27220 Probable disease resistance protein. No verified direct reference in this release
At4g26090 Disease resistance (R) protein that specifically recognizes the AvrRpt2 type III effector avirulence protein from Pseudomonas syringae. No verified direct reference in this release
At1g12280 Disease resistance protein that mediates defense responses against the bacterial pathogen Pseudomonas syringae pv tomato strain DC3000, and the virulent oomycete Hyaloperonospora arabidopsidis isolate Noco2.
The MEKK1-MKK1/MKK2-MPK4 kinase cascade negatively regulates immunity mediated by a mitogen-activated protein kinase kinase kinase in Arabidopsis.2012 · DOI: 10.1105/tpc.112.097253
At4g10780 Potential disease resistance protein. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_038946 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0002220 innate immune response activating cell surface receptor signaling pathway Biological Process
GO:0006952 defense response Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0016045 detection of bacterium Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0098542 defense response to other organism Biological Process
GO:2000377 regulation of reactive oxygen species metabolic process Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference
ath:AT1G12280
ath:AT4G10780
ath:AT4G26090
ath:AT4G27190
ath:AT4G27220
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.602
Rank 1 · LXL04_038946 · OH-1004
Cytoplasm0.241
Rank 2 · LXL04_038946 · OH-1004
Nucleus0.166
Rank 3 · LXL04_038946 · OH-1004
Endoplasmic reticulum0.076
Rank 4 · LXL04_038946 · OH-1004
Plastid0.033
Rank 5 · LXL04_038946 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00931.29NB-ARC158-319 aa
PF23559.2WHD_DRP406-472 aa
PF13855.13LRR_8522-580 aa
PF23598.2LRR_14544-887 aa
PF12799.14LRR_4548-587 aa
PF12799.14LRR_4592-630 aa
PF13855.13LRR_8592-644 aa
PF23247.2LRR_RPS2737-847 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_038946PF00931.29NB-ARC1583197.7e-37127.2
LXL04_038946PF23559.2WHD_DRP4064725.7e-1039.8
LXL04_038946PF13855.13LRR_85225807.3e-1142.4
LXL04_038946PF23598.2LRR_145448871.6e-1660.8
LXL04_038946PF12799.14LRR_45485872.4e-1144.2
LXL04_038946PF12799.14LRR_45926302.4e-1144.2
LXL04_038946PF13855.13LRR_85926447.3e-1142.4
LXL04_038946PF23247.2LRR_RPS27378479.7e-2691.4
LXL04_038946PF23247.2LRR_RPS28069099.7e-2691.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9T048Arabidopsis thalianaDisease resistance protein At4g2719032.124%Swiss-Protmoderate database homology
O81825Arabidopsis thalianaProbable disease resistance protein At4g2722034.884%Swiss-Protmoderate database homology
Q42484Arabidopsis thalianaDisease resistance protein RPS231.386%Swiss-Protmoderate database homology
P60838Arabidopsis thalianaDisease resistance protein SUMM234.934%Swiss-Protmoderate database homology
O82484Arabidopsis thalianaPutative disease resistance protein At4g1078036.289%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser