LXL04_038720 | RubberDandelionOmics

Gene overview

LXL04_038720

Reference: OH-1004 Chr: Chr09 Coordinates: 48844949-48845833 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

648 bp · LXL04_038720|LXL04_038720|OH1004|cDNA

ATGGCCACCAAGGGACGAGGCGGCAGCGGCGGAGGGAGAGAGGAGGAGCTAGCAGCAGCTCAGATGAGCAAAACCCTAAAAGAAGGTGAAAAATTCCTCGCTCCAACCAGACGACCCGACGGCACTCTTCGCAAGCCCATTCGAATTAGGGCTGGTTACGTCCCTCAAGATGAAGTCGCCGTGTACAAATCCAAAGGCTCCCAGTTGAAGGAGGAAACTGTGCCTCCTGGCTATGATCCTGTGGAAGATGTTGTGAACAA...

CDS

Download CDS FASTA

648 bp · LXL04_038720|LXL04_038720|OH1004|CDS

ATGGCCACCAAGGGACGAGGCGGCAGCGGCGGAGGGAGAGAGGAGGAGCTAGCAGCAGCTCAGATGAGCAAAACCCTAAAAGAAGGTGAAAAATTCCTCGCTCCAACCAGACGACCCGACGGCACTCTTCGCAAGCCCATTCGAATTAGGGCTGGTTACGTCCCTCAAGATGAAGTCGCCGTGTACAAATCCAAAGGCTCCCAGTTGAAGGAGGAAACTGTGCCTCCTGGCTATGATCCTGTGGAAGATGTTGTGAACAA...

Protein

Download Protein FASTA

215 aa · LXL04_038720|LXL04_038720|OH1004|PROTEIN

MATKGRGGSGGGREEELAAAQMSKTLKEGEKFLAPTRRPDGTLRKPIRIRAGYVPQDEVAVYKSKGSQLKEETVPPGYDPVEDVVNKPKSKSAKRNERKKEKRLQSTASDESKNEVSSIGDEEQALGSQMNKITISGNPSVAAPPPSNSTDCLATEDHVPDIDKRIRALKKKIRLTEALQQKTEHDLKPEQMEKVAKLEDWRRELKLLEEASVGS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038720`
TK1151 ID	TkA04G456070
OH-1004 ID	LXL04_038720
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038720

Location Chr09:48844949-48845833 (-)

Description Similar to PYM: Partner of Y14 and mago

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11400`	Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038720 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0006417 regulation of translation Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0051028 mRNA transport Biological Process

GO:1903259 exon-exon junction complex disassembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0030054 cell junction Cellular Component

KEGG gene cross-reference

ath:AT1G11400

bmor:692986

dre:393566

mmu:78428

sasa:106572489

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.519

Rank 1 · LXL04_038720 · OH-1004

Cytoplasm0.518

Rank 2 · LXL04_038720 · OH-1004

Cell membrane0.064

Rank 3 · LXL04_038720 · OH-1004

Endoplasmic reticulum0.048

Rank 4 · LXL04_038720 · OH-1004

Mitochondrion0.047

Rank 5 · LXL04_038720 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09282.16Mago-bind29-55 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038720	`PF09282.16`	Mago-bind	29	55	1.2e-12	48.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LPZ4`	Arabidopsis thaliana	Partner of Y14 and mago	56.000%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card