LXL04_038498 | RubberDandelionOmics

Gene overview

LXL04_038498

Reference: OH-1004 Chr: Chr09 Coordinates: 42491665-42497636 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2346 bp · LXL04_038498|LXL04_038498|OH1004|cDNA

ATGACGTTTCGATCTGTGTTCGATGCTCCCTTCATTAGAACTGAATTCGATCAAGCTGGAATCAGTACTCAGTTCATCCCTACAATTTGGAAATACGTCGTACAGAATCCTAATTGCGAATGGCGAGATATCCCTTCACTGCCTTCCGCAGCTTACTCGTTACTTTCTTCCAAGTTCAAATCCTGCACTTCTATCGTCGACTCCGTTTTCAACTCCACGGATCAAGTTACCACCAAACTCCTCATTAAGTTGCAGAATGG...

CDS

Download CDS FASTA

2346 bp · LXL04_038498|LXL04_038498|OH1004|CDS

ATGACGTTTCGATCTGTGTTCGATGCTCCCTTCATTAGAACTGAATTCGATCAAGCTGGAATCAGTACTCAGTTCATCCCTACAATTTGGAAATACGTCGTACAGAATCCTAATTGCGAATGGCGAGATATCCCTTCACTGCCTTCCGCAGCTTACTCGTTACTTTCTTCCAAGTTCAAATCCTGCACTTCTATCGTCGACTCCGTTTTCAACTCCACGGATCAAGTTACCACCAAACTCCTCATTAAGTTGCAGAATGG...

Protein

Download Protein FASTA

781 aa · LXL04_038498|LXL04_038498|OH1004|PROTEIN

MTFRSVFDAPFIRTEFDQAGISTQFIPTIWKYVVQNPNCEWRDIPSLPSAAYSLLSSKFKSCTSIVDSVFNSTDQVTTKLLIKLQNGESIEAVIMRYDSSLGKLNGKPRPGGPRSTLCISSQVGCKMGCKFCATGTMGFKSNLSTGEIVEQLVHASRISPIRNVVFMGMGEPLNNYNALVEAIRVMTAFPFQLSPKKITVSTVGIIPAIKKFHGDLPNLNLAVSLHAPVQDIRCKIMPAARAFPLERLMNALAEYQKKSQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038498`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038498

Location Chr09:42491665-42497636 (+)

Description Similar to rlmN1: Dual-specificity RNA methyltransferase RlmN 1 (Myxococcus xanthus (strain DK 1622)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46290`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038498 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009741 response to brassinosteroid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0030488 tRNA methylation Biological Process

GO:0070475 rRNA base methylation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0043680 filiform apparatus Cellular Component

GO:0000049 tRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G46290

mxa:MXAN_1275

nmr:Nmar_1385

sfu:Sfum_4057

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.249

Rank 1 · LXL04_038498 · OH-1004

Nucleus0.190

Rank 2 · LXL04_038498 · OH-1004

Cell membrane0.184

Rank 3 · LXL04_038498 · OH-1004

Plastid0.155

Rank 4 · LXL04_038498 · OH-1004

Endoplasmic reticulum0.135

Rank 5 · LXL04_038498 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04055.28Radical_SAM120-278 aa

PF00069.32Pkinase476-745 aa

PF07714.24PK_Tyr_Ser-Thr479-748 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038498	`PF04055.28`	Radical_SAM	120	278	2.7e-13	51.2
LXL04_038498	`PF00069.32`	Pkinase	476	745	5.2e-32	112.0
LXL04_038498	`PF07714.24`	PK_Tyr_Ser-Thr	479	748	3e-40	138.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX66`	Arabidopsis thaliana	Receptor-like protein kinase HERK 1	34.264%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card