Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1905 bp · LXL04_038386|LXL04_038386|OH1004|cDNA
ATGGAGCTAAAGCCAGGCCTCTCCGCTTTGGTCACCGGAGGTGCCTCCGGGATCGGTAGAGCTCTTTGCATAGCTCTTGCCCAAAAGGGTATATTCGTCACAGTTGTTGATTTTTCAACTGAAAGGGGCGAAGAGGTCGCATTACTTTCACAGAAAGAAAATCTCAAATTCCATCCCCAATTAAAATCCCCATCTTCTATCTTCGTAAAATGCGATGTCAGTAACAAAGAAGAAGTCGCAAATGCATTTGAAAAACACCT...
1905 bp · LXL04_038386|LXL04_038386|OH1004|CDS
ATGGAGCTAAAGCCAGGCCTCTCCGCTTTGGTCACCGGAGGTGCCTCCGGGATCGGTAGAGCTCTTTGCATAGCTCTTGCCCAAAAGGGTATATTCGTCACAGTTGTTGATTTTTCAACTGAAAGGGGCGAAGAGGTCGCATTACTTTCACAGAAAGAAAATCTCAAATTCCATCCCCAATTAAAATCCCCATCTTCTATCTTCGTAAAATGCGATGTCAGTAACAAAGAAGAAGTCGCAAATGCATTTGAAAAACACCT...
Protein
Download Protein FASTA634 aa · LXL04_038386|LXL04_038386|OH1004|PROTEIN
MELKPGLSALVTGGASGIGRALCIALAQKGIFVTVVDFSTERGEEVALLSQKENLKFHPQLKSPSSIFVKCDVSNKEEVANAFEKHLDAFGGLDICINCAGIATSVPFYKDESDGSKSWRHAINVNLVAVIGCTHRAIKIMEAAKKPGVIINLGSASGLYPMITDPIYSASKGGVVMFTRSLMTYKKKGIRVNVLCPEFILTEMAEKVGSQFIERMGGYVSMDTLIQGAFELISDETKAGACLWITKRRGMEYWPTPTEQ...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_038386 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_038386 |
|---|---|
| Location | Chr09:39428587-39432765 (-) |
| Description | Similar to Zadh2: Prostaglandin reductase-3 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006629 lipid metabolic process Biological Process GO:0007567 parturition Biological Process GO:0030728 ovulation Biological Process GO:0032355 response to estradiol Biological Process GO:0032496 response to lipopolysaccharide Biological Process GO:0045471 response to ethanol Biological Process GO:0045786 negative regulation of cell cycle Biological Process GO:0070493 thrombin-activated receptor signaling pathway Biological Process GO:1904707 positive regulation of vascular associated smooth muscle cell proliferation Biological Process GO:1905344 prostaglandin catabolic process Biological Process GO:1905828 regulation of prostaglandin catabolic process Biological Process GO:2001301 lipoxin biosynthetic process Biological Process |
| KEGG gene cross-reference | bta:532505 hsa:284273 mmu:15446 mmu:225791 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00106.32adh_short9-210 aaPF08659.17KR9-113 aaPF01370.28Epimerase9-132 aaPF13561.13adh_short_C215-211 aaPF08240.18ADH_N317-403 aaPF00107.33ADH_zinc_N444-578 aaPF13602.13ADH_zinc_N_2476-621 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_038386 | PF00106.32 | adh_short | 9 | 210 | 4.6e-47 | 160.7 |
| LXL04_038386 | PF08659.17 | KR | 9 | 113 | 1.7e-07 | 32.1 |
| LXL04_038386 | PF01370.28 | Epimerase | 9 | 132 | 4.7e-07 | 30.2 |
| LXL04_038386 | PF13561.13 | adh_short_C2 | 15 | 211 | 4.4e-33 | 115.5 |
| LXL04_038386 | PF08240.18 | ADH_N | 317 | 403 | 2.4e-10 | 41.3 |
| LXL04_038386 | PF00107.33 | ADH_zinc_N | 444 | 578 | 2.2e-27 | 96.3 |
| LXL04_038386 | PF13602.13 | ADH_zinc_N_2 | 476 | 621 | 2.8e-20 | 74.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.