LXL04_038380 | RubberDandelionOmics

Gene overview

LXL04_038380

Reference: OH-1004 Chr: Chr09 Coordinates: 39082720-39083652 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

933 bp · LXL04_038380|LXL04_038380|OH1004|cDNA

ATGGATTCATCACCGGTCGATATCGTTAAAGAAATTCCCGGAGTCATTCGAGTATACAAAGATGGCCGATTCCAGAAACTCAGCGGCACCGATATCGTTCCCGCCGGCAATGATCCATCTTCCGGCGTCCAATCCAAAGACGTCGTCATCTCACCTGAAACCAACGTCTCCGCTAGGCTTTACCTTCCGAAAACCCCCACCAAAAACCTCCCCCTTCTGATCTACTTCCACGGCGGCGGATTCATCGTCGAAACAGCCGC...

CDS

Download CDS FASTA

933 bp · LXL04_038380|LXL04_038380|OH1004|CDS

ATGGATTCATCACCGGTCGATATCGTTAAAGAAATTCCCGGAGTCATTCGAGTATACAAAGATGGCCGATTCCAGAAACTCAGCGGCACCGATATCGTTCCCGCCGGCAATGATCCATCTTCCGGCGTCCAATCCAAAGACGTCGTCATCTCACCTGAAACCAACGTCTCCGCTAGGCTTTACCTTCCGAAAACCCCCACCAAAAACCTCCCCCTTCTGATCTACTTCCACGGCGGCGGATTCATCGTCGAAACAGCCGC...

Protein

Download Protein FASTA

310 aa · LXL04_038380|LXL04_038380|OH1004|PROTEIN

MDSSPVDIVKEIPGVIRVYKDGRFQKLSGTDIVPAGNDPSSGVQSKDVVISPETNVSARLYLPKTPTKNLPLLIYFHGGGFIVETAASPDYHNFLNLIAAESNVVIVSVDYRTAPEHPVPTCFNDSWEAIKWVAGNCREPWINDYADLQNVYFAGDSAGANIAHQMAVRFGSENPRLDIYLRGIILLHPYFMGEDRIGSEGEHPWKPFLDEMYILAHPGTSGLDDPLINPDKDPKVSDLGCSRVLVCVAEKEILRDRGWY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038380`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038380

Location Chr09:39082720-39083652 (+)

Description Similar to CXE2: Probable carboxylesterase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g47480`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At3g48700`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At3g48690`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At2g03550`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038380 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016787 hydrolase activity Molecular Function

GO:0016829 lyase activity Molecular Function

GO:0106435 carboxylesterase activity Molecular Function

KEGG gene cross-reference

ag:BAM20978

ath:AT1G47480

ath:AT2G03550

ath:AT3G48690

ath:AT3G48700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.863

Rank 1 · LXL04_038380 · OH-1004

Nucleus0.331

Rank 2 · LXL04_038380 · OH-1004

Endoplasmic reticulum0.048

Rank 3 · LXL04_038380 · OH-1004

Cell membrane0.037

Rank 4 · LXL04_038380 · OH-1004

Mitochondrion0.033

Rank 5 · LXL04_038380 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20434.6BD-FAE60-169 aa

PF00135.35COesterase61-166 aa

PF07859.20Abhydrolase_373-287 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038380	`PF20434.6`	BD-FAE	60	169	1.3e-14	55.0
LXL04_038380	`PF00135.35`	COesterase	61	166	7.5e-08	32.5
LXL04_038380	`PF07859.20`	Abhydrolase_3	73	287	2.8e-50	171.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SX78`	Arabidopsis thaliana	Probable carboxylesterase 2	42.949%	Swiss-Prot	moderate database homology
`Q9SMM9`	Arabidopsis thaliana	Probable carboxylesterase 13	43.293%	Swiss-Prot	moderate database homology
`Q9SMN0`	Arabidopsis thaliana	Probable carboxylesterase 12	45.511%	Swiss-Prot	moderate database homology
`Q9ZQ91`	Arabidopsis thaliana	Probable carboxylesterase 7	45.192%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card