LXL04_038353 | RubberDandelionOmics

Gene overview

LXL04_038353

Reference: OH-1004 Chr: Chr09 Coordinates: 38332943-38338110 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3097 bp · LXL04_038353|LXL04_038353|OH1004|cDNA

ATGGAAACGTTAGAGGATCTGATCGAAGAAGCAAAGCTTCGTACTGTATGGTGGGGTATCTGCATTTTCGCTGTCACATACCTTTTAACACACACGAGCAAATTAATGTGGATGAATGTTCCTATAGCAATTCTTCTGGTATCAGGCGTTCATATTTTATTAACCCAAGTAGATCTCCGTTGGAAGATCAGGAAATCAAACCAACATTCATATCTAGCACACTTACAGAAAAAACAATTGTCTGTAAATGACTCTCGTCT...

CDS

Download CDS FASTA

3081 bp · LXL04_038353|LXL04_038353|OH1004|CDS

ATGGAAACGTTAGAGGATCTGATCGAAGAAGCAAAGCTTCGTACTGTATGGTGGGGTATCTGCATTTTCGCTGTCACATACCTTTTAACACACACGAGCAAATTAATGTGGATGAATGTTCCTATAGCAATTCTTCTGGTATCAGGCGTTCATATTTTATTAACCCAAGTAGATCTCCGTTGGAAGATCAGGAAATCAAACCAACATTCATATCTAGCACACTTACAGAAAAAACAATTGTCTGTAAATGACTCTCGTCT...

Protein

Download Protein FASTA

1026 aa · LXL04_038353|LXL04_038353|OH1004|PROTEIN

METLEDLIEEAKLRTVWWGICIFAVTYLLTHTSKLMWMNVPIAILLVSGVHILLTQVDLRWKIRKSNQHSYLAHLQKKQLSVNDSRLTTLPPPPKWKRKIDSPVVEAAMDDFTNKILQEFVVDLWYSSITPDKEAPQLIHSIIMDIFAEVSMRVKDINLVDMLTRDVVDLVGDHIELFRKNQASIGREVMVTLSSEERDERLKHHLMASKELHPALISPESEYKYLKRIMGALLTAVLRPREAQCPIENGPTYLPLSHSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038353`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_038353`
Location	Chr09:38332943-38338110 (+)
Description	Similar to Sgk3: Serine/threonine-protein kinase Sgk3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_038353` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0001881 receptor recycling Biological Process GO:0006622 protein targeting to lysosome Biological Process GO:0008333 endosome to lysosome transport Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0045022 early endosome to late endosome transport Biological Process GO:0005764 lysosome Cellular Component GO:0005769 early endosome Cellular Component GO:0005770 late endosome Cellular Component GO:0010008 endosome membrane Cellular Component GO:0031410 cytoplasmic vesicle Cellular Component GO:0031901 early endosome membrane Cellular Component GO:0031902 late endosome membrane Cellular Component
KEGG gene cross-reference	hsa:64089 mmu:170755 mmu:74718 pon:100173483 rno:64088 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.332

Rank 1 · LXL04_038353 · OH-1004

Golgi apparatus0.299

Rank 2 · LXL04_038353 · OH-1004

Cytoplasm0.181

Rank 3 · LXL04_038353 · OH-1004

Cell membrane0.176

Rank 4 · LXL04_038353 · OH-1004

Nucleus0.138

Rank 5 · LXL04_038353 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02194.21PXA102-247 aa

PF00787.30PX577-653 aa

PF08628.18Nexin_C848-983 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038353	`PF02194.21`	PXA	102	247	2e-28	100.6
LXL04_038353	`PF00787.30`	PX	577	653	2.1e-14	54.5
LXL04_038353	`PF08628.18`	Nexin_C	848	983	2e-26	93.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card