LXL04_038133 | RubberDandelionOmics

Gene overview

LXL04_038133

Reference: OH-1004 Chr: Chr09 Coordinates: 31943257-31945316 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1783 bp · LXL04_038133|LXL04_038133|OH1004|cDNA

TTTAAACAGATCGATATCAAAACCAATCGAAGAATCAATCTGAAATTCAAGTTGTTAGAGATCTGTAAAGCTTCAATCGAATCAAAAGAAGATGGATTTTGAGTTGAGAAGAGCGAGAGAGAAATTGGAGAAAGAGCAAAAGGATAGGAAAGAGAAGGCCAGGGTTAGATTGGATAGAGAGAGGAAAGCCAAACAAGAAGCTCTTCGTCAACGTGAGGCGATCGAAGCTTCTCAACGAGCTCGTAGAATCGATGCCATGG...

CDS

Download CDS FASTA

1692 bp · LXL04_038133|LXL04_038133|OH1004|CDS

ATGGATTTTGAGTTGAGAAGAGCGAGAGAGAAATTGGAGAAAGAGCAAAAGGATAGGAAAGAGAAGGCCAGGGTTAGATTGGATAGAGAGAGGAAAGCCAAACAAGAAGCTCTTCGTCAACGTGAGGCGATCGAAGCTTCTCAACGAGCTCGTAGAATCGATGCCATGGAAGCCCAACTTAAGGCAGATCAACAGATGGAAGAAAACATACTAATCGGAAGAGGAATTTCCTTCATTCGAGTTCTCGAAGCCGTACCATT...

Protein

Download Protein FASTA

563 aa · LXL04_038133|LXL04_038133|OH1004|PROTEIN

MDFELRRAREKLEKEQKDRKEKARVRLDRERKAKQEALRQREAIEASQRARRIDAMEAQLKADQQMEENILIGRGISFIRVLEAVPFEGPGDKIKLPPSCFNDLSSEGAFDKGPLHFQLSLHHQTTSPPSEPTTTHAGVLEFTADEGTVAIPPHIWNNLYSKNPQLTPLIQVKYVWLPKGTYAKLQSQQLGFSDIPNHKAVLETTLRQHATLSQSDILTVKHGTLTYHLQVLSLKPSPSVSVLETDIEVDIVGPDTLPEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038133`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038133

Location Chr09:31943257-31945316 (+)

Description Similar to ufd1: Ubiquitin fusion degradation protein 1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g38930`	Essential component of the ubiquitin-dependent proteolytic pathway which degrades ubiquitin fusion proteins (By similarity).	No verified direct reference in this release
`At2g21270`	Essential component of the ubiquitin-dependent proteolytic pathway which degrades ubiquitin fusion proteins (By similarity).	The CDC48 complex mediates ubiquitin-dependent degradation of intra-chloroplast proteins in plants.2022 · DOI: 10.1016/j.celrep.2022.110664

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038133 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0030970 retrograde protein transport, ER to cytosol Biological Process

GO:0032480 negative regulation of type I interferon production Biological Process

GO:0034614 cellular response to reactive oxygen species Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0039536 negative regulation of RIG-I signaling pathway Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0071218 cellular response to misfolded protein Biological Process

GO:0072344 rescue of stalled cytosolic ribosome Biological Process

GO:1902882 regulation of response to oxidative stress Biological Process

GO:1990116 ribosome-associated ubiquitin-dependent protein catabolic process Biological Process

KEGG gene cross-reference

ath:AT2G21270

ath:AT4G38930

ddi:DDB_G0271122

hsa:7353

rno:84478

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.698

Rank 1 · LXL04_038133 · OH-1004

Nucleus0.426

Rank 2 · LXL04_038133 · OH-1004

Mitochondrion0.076

Rank 3 · LXL04_038133 · OH-1004

Peroxisome0.055

Rank 4 · LXL04_038133 · OH-1004

Endoplasmic reticulum0.046

Rank 5 · LXL04_038133 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03152.22UFD1_N190-178 aa

PF24842.2UFD1_N2179-254 aa

PF23580.2Znf_XAF1_N402-428 aa

PF21366.4TRAFD1-XIAF1_ZnF526-556 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038133	`PF03152.22`	UFD1_N1	90	178	9.3e-19	67.5
LXL04_038133	`PF24842.2`	UFD1_N2	179	254	1.8e-26	92.7
LXL04_038133	`PF23580.2`	Znf_XAF1_N	402	428	3e-12	46.4
LXL04_038133	`PF21366.4`	TRAFD1-XIAF1_ZnF	526	556	1.9e-09	37.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W570`	Arabidopsis thaliana	Ubiquitin fusion degradation protein 1 C	39.024%	Swiss-Prot	weak database homology
`Q9SJV0`	Arabidopsis thaliana	Ubiquitin fusion degradation protein 1 B	37.805%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card