LXL04_037908 | RubberDandelionOmics

Gene overview

LXL04_037908

Reference: OH-1004 Chr: Chr09 Coordinates: 24835427-24837818 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2343 bp · LXL04_037908|LXL04_037908|OH1004|cDNA

ATGGCTTCATACATGAATTGTTTCACCTTCTTGCAAACCATCTCACTTGTATACTTCTTGATCACACTCACATGCACCAGTGGATCATACCTAAGCCATGATGAAGAATGCTCAGCCTTGTTTCAGTTTAAACAAAACATGATTCATCAAGATGATGTGGATTGTGCTGCCAGTTGGTTTCAAGCAAATAATGCATCGGATTCTGGTTTTGGTTGTTGTTCGTGGTACGGGGTGGAGTGTAGCAATGATCATAGGTATGG...

CDS

Download CDS FASTA

2343 bp · LXL04_037908|LXL04_037908|OH1004|CDS

ATGGCTTCATACATGAATTGTTTCACCTTCTTGCAAACCATCTCACTTGTATACTTCTTGATCACACTCACATGCACCAGTGGATCATACCTAAGCCATGATGAAGAATGCTCAGCCTTGTTTCAGTTTAAACAAAACATGATTCATCAAGATGATGTGGATTGTGCTGCCAGTTGGTTTCAAGCAAATAATGCATCGGATTCTGGTTTTGGTTGTTGTTCGTGGTACGGGGTGGAGTGTAGCAATGATCATAGGTATGG...

Protein

Download Protein FASTA

780 aa · LXL04_037908|LXL04_037908|OH1004|PROTEIN

MASYMNCFTFLQTISLVYFLITLTCTSGSYLSHDEECSALFQFKQNMIHQDDVDCAASWFQANNASDSGFGCCSWYGVECSNDHRYGHVVGLDLSERSLCGHINSTSTLFSLVHLQSLNLAMNNFDESQIPSEIAHLKKLRSLNLSYSGFTGQIPAEISQLHQLSSLDLSRNSQQLESTRGFNNLVKNLTRLEELHLSGVDISSSLPHFLANFSSLRLLTLQECSLLNAFPAAILELPKLKILNLAYNDNLTGSFPKFRN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037908`
TK1151 ID	TkAUNG027420
OH-1004 ID	LXL04_037908
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	68.200
Protein coverage (%)	TK1151 85.088 / OH-1004 24.103 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037908

Location Chr09:24835427-24837818 (+)

Description Similar to RLP6: Receptor-like protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g45616`	Receptor-like protein 6.	No verified direct reference in this release
`At1g47890`	Receptor-like protein 7.	No verified direct reference in this release
`At3g11080`	Receptor-like protein 35.	No verified direct reference in this release
`At3g11010`	Receptor-like protein 34.	No verified direct reference in this release
`At5g27060`	Receptor-like protein 53.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037908 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G45616

ath:AT1G47890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.799

Rank 1 · LXL04_037908 · OH-1004

Endoplasmic reticulum0.119

Rank 2 · LXL04_037908 · OH-1004

Cytoplasm0.072

Rank 3 · LXL04_037908 · OH-1004

Nucleus0.071

Rank 4 · LXL04_037908 · OH-1004

Extracellular0.027

Rank 5 · LXL04_037908 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23598.2LRR_1492-289 aa

PF13855.13LRR_8114-172 aa

PF25013.1LRR_Zer-1184-259 aa

PF23598.2LRR_14209-339 aa

PF23598.2LRR_14327-499 aa

PF13855.13LRR_8382-440 aa

PF13855.13LRR_8430-491 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037908	`PF23598.2`	LRR_14	92	289	5.4e-26	91.9
LXL04_037908	`PF13855.13`	LRR_8	114	172	1.1e-30	105.9
LXL04_037908	`PF25013.1`	LRR_Zer-1	184	259	2.7e-09	38.0
LXL04_037908	`PF23598.2`	LRR_14	209	339	5.4e-26	91.9
LXL04_037908	`PF23598.2`	LRR_14	327	499	5.4e-26	91.9
LXL04_037908	`PF13855.13`	LRR_8	382	440	1.1e-30	105.9
LXL04_037908	`PF13855.13`	LRR_8	430	491	1.1e-30	105.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C637`	Arabidopsis thaliana	Receptor-like protein 6	36.894%	Swiss-Prot	moderate database homology
`Q9C699`	Arabidopsis thaliana	Receptor-like protein 7	38.289%	Swiss-Prot	moderate database homology
`Q9SRL7`	Arabidopsis thaliana	Receptor-like protein 35	34.241%	Swiss-Prot	moderate database homology
`Q9SRL2`	Arabidopsis thaliana	Receptor-like protein 34	32.634%	Swiss-Prot	moderate database homology
`Q9S9U3`	Arabidopsis thaliana	Receptor-like protein 53	30.207%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card