LXL04_037286 | RubberDandelionOmics

Gene overview

LXL04_037286

Reference: OH-1004 Chr: Chr09 Coordinates: 5093525-5105354 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1584 bp · LXL04_037286|LXL04_037286|OH1004|cDNA

ATGGCACTTCTTCACTTGCCGGCAATCAAAGTATATTGCTTGACAGAGAAGAAGCATAAAGATGTTCAAAGCAGACCATTGAAGCTTGGAGAATCTAACTCGAGAACCACAACTTACCGAAAAGGTTCATTTCAACAAGAACGCAAACCCCAGAAAGTGAGTCTGGAAATCTCACCTCATAGAGCTGTGTCCGCAGTGAGGTTAATGCGGATAGAATTCGGTGGTGCTTTTGCTGACCTTTTGAACGAGAAAGGAAAGGG...

CDS

Download CDS FASTA

1584 bp · LXL04_037286|LXL04_037286|OH1004|CDS

ATGGCACTTCTTCACTTGCCGGCAATCAAAGTATATTGCTTGACAGAGAAGAAGCATAAAGATGTTCAAAGCAGACCATTGAAGCTTGGAGAATCTAACTCGAGAACCACAACTTACCGAAAAGGTTCATTTCAACAAGAACGCAAACCCCAGAAAGTGAGTCTGGAAATCTCACCTCATAGAGCTGTGTCCGCAGTGAGGTTAATGCGGATAGAATTCGGTGGTGCTTTTGCTGACCTTTTGAACGAGAAAGGAAAGGG...

Protein

Download Protein FASTA

527 aa · LXL04_037286|LXL04_037286|OH1004|PROTEIN

MALLHLPAIKVYCLTEKKHKDVQSRPLKLGESNSRTTTYRKGSFQQERKPQKVSLEISPHRAVSAVRLMRIEFGGAFADLLNEKGKGSGDNEMGYVERTLGFCTRDLDDRDLRLVTDIVGGTIRWRKYLDYLILSLCHDPNSFSHMEPLLLQILRIGFYEIVKLEVPSYAVINENVELAKTALRPGAGNMVNGILRKLVALKESNSLPLPQLEGDDRAQARALATIYSHPVWMVRRWIKELGREDAIKLMKWNNSNPSFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037286`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_037286`
Location	Chr09:5093525-5105354 (+)
Description	Similar to rsmB: Probable ribosomal RNA small subunit methyltransferase B (Bacillus subtilis (strain 168)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_037286` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0001510 RNA methylation Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0070475 rRNA base methylation Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0003723 RNA binding Molecular Function GO:0008649 rRNA methyltransferase activity Molecular Function GO:0009383 rRNA (cytosine-C5-)-methyltransferase activity Molecular Function
KEGG gene cross-reference	bsu:BSU15740 syn:slr0679 ypg:YpAngola_A0613 ypo:BZ17_2920 yps:YPTB3667 ypy:YPK_0314 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.498

Rank 1 · LXL04_037286 · OH-1004

Mitochondrion0.429

Rank 2 · LXL04_037286 · OH-1004

Cytoplasm0.130

Rank 3 · LXL04_037286 · OH-1004

Nucleus0.063

Rank 4 · LXL04_037286 · OH-1004

Peroxisome0.043

Rank 5 · LXL04_037286 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01029.24NusB96-198 aa

PF22458.2RsmF-B_ferredox229-300 aa

PF01189.24Methyltr_RsmB-F328-522 aa

PF01728.26FtsJ333-469 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037286	`PF01029.24`	NusB	96	198	7.1e-23	82.2
LXL04_037286	`PF22458.2`	RsmF-B_ferredox	229	300	1.3e-10	42.0
LXL04_037286	`PF01189.24`	Methyltr_RsmB-F	328	522	1.5e-51	175.6
LXL04_037286	`PF01728.26`	FtsJ	333	469	2.2e-06	28.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card