LXL04_037248 | RubberDandelionOmics

Gene overview

LXL04_037248

Reference: OH-1004 Chr: Chr09 Coordinates: 4190142-4198264 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2655 bp · LXL04_037248|LXL04_037248|OH1004|cDNA

ATGGGCGACTACACAGAAGATCATAAGTCTCCATTAGTCCAATGCTCGGATTCATCCGACGTAGAATCTCACGAGCTCACACACAGAACTGGGACGATATGGACGGCGATTGCTCATATAATAACCGGAGTTATGGGGGCTGGAGTGTTATCATTGGCATGGAGCTTGGCTCAACTCGGATGGCTGTTTGGTCCTCTTGCGATCGTTACCTTTGCTGCAGTCACCGCAGTTTCAAACTCCCTTCTCTCCGATTGCTACAG...

CDS

Download CDS FASTA

2655 bp · LXL04_037248|LXL04_037248|OH1004|CDS

ATGGGCGACTACACAGAAGATCATAAGTCTCCATTAGTCCAATGCTCGGATTCATCCGACGTAGAATCTCACGAGCTCACACACAGAACTGGGACGATATGGACGGCGATTGCTCATATAATAACCGGAGTTATGGGGGCTGGAGTGTTATCATTGGCATGGAGCTTGGCTCAACTCGGATGGCTGTTTGGTCCTCTTGCGATCGTTACCTTTGCTGCAGTCACCGCAGTTTCAAACTCCCTTCTCTCCGATTGCTACAG...

Protein

Download Protein FASTA

884 aa · LXL04_037248|LXL04_037248|OH1004|PROTEIN

MGDYTEDHKSPLVQCSDSSDVESHELTHRTGTIWTAIAHIITGVMGAGVLSLAWSLAQLGWLFGPLAIVTFAAVTAVSNSLLSDCYRSPDSEDDDHRHASFLQAVRFFLGEKNQRICAVLLNESLFGNDIAYTIATATSIRAILKSNCYHKQGHDADCTYEDNIYMLLFGLVQIVMSQIPNFHDMAWLSVVAAIMSFAYSTIGIGLGFAKVIENGEIMGSIGGVPETSAIDKVWLVFQGLGDIAFAYPYSIILLEIQDTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037248`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037248

Location Chr09:4190142-4198264 (-)

Description Similar to AAP7: Probable amino acid permease 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23810`	Amino acid-proton symporter.	No verified direct reference in this release
`At1g77380`	Amino acid-proton symporter.	Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.1995 · DOI: 10.1074/jbc.270.27.16315
`At5g09220`	Amino acid-proton symporter.	Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.1995 · DOI: 10.1074/jbc.270.27.16315 Differential expression of two related amino acid transporters with differing substrate specificity in Arabidopsis thaliana.1993 · DOI: 10.1046/j.1365-313x.1993.04060993.x
`At1g10010`	Amino acid-proton symporter.	The amino acid permease AAP8 is important for early seed development in Arabidopsis thaliana.2007 · DOI: 10.1007/s00425-007-0527-x
`At1g58360`	Amino acid-proton symporter.	AAP1 transports uncharged amino acids into roots of Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03045.x AAP1 regulates import of amino acids into developing Arabidopsis embryos.2009 · DOI: 10.1111/j.1365-313x.2009.03890.x Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.1995 · DOI: 10.1074/jbc.270.27.16315 Differential expression of two related amino acid transporters with differing substrate specificity in Arabidopsis thaliana.1993 · DOI: 10.1046/j.1365-313x.1993.04060993.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037248 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003333 amino acid transmembrane transport Biological Process

GO:0006865 amino acid transport Biological Process

GO:0006952 defense response Biological Process

GO:0015800 acidic amino acid transport Biological Process

GO:0015802 basic amino acid transport Biological Process

GO:0015804 neutral amino acid transport Biological Process

GO:0110126 phloem loading Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0015171 amino acid transmembrane transporter activity Molecular Function

GO:0015174 basic amino acid transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G77380

ath:AT5G09220

ath:AT5G23810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.554

Rank 1 · LXL04_037248 · OH-1004

Lysosome / Vacuole0.221

Rank 2 · LXL04_037248 · OH-1004

Endoplasmic reticulum0.129

Rank 3 · LXL04_037248 · OH-1004

Cytoplasm0.111

Rank 4 · LXL04_037248 · OH-1004

Golgi apparatus0.060

Rank 5 · LXL04_037248 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01490.25Aa_trans29-427 aa

PF01490.25Aa_trans454-879 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037248	`PF01490.25`	Aa_trans	29	427	7.9e-181	601.9
LXL04_037248	`PF01490.25`	Aa_trans	454	879	7.9e-181	601.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FF99`	Arabidopsis thaliana	Probable amino acid permease 7	61.894%	Swiss-Prot	weak database homology
`Q39134`	Arabidopsis thaliana	Amino acid permease 3	51.157%	Swiss-Prot	weak database homology
`Q38967`	Arabidopsis thaliana	Amino acid permease 2	50.831%	Swiss-Prot	weak database homology
`O80592`	Arabidopsis thaliana	Amino acid permease 8	50.711%	Swiss-Prot	weak database homology
`Q42400`	Arabidopsis thaliana	Amino acid permease 1	47.586%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card