LXL04_037236 | RubberDandelionOmics

Gene overview

LXL04_037236

Reference: OH-1004 Chr: Chr09 Coordinates: 3837766-3844045 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1476 bp · LXL04_037236|LXL04_037236|OH1004|cDNA

ATGGATTTGGGAAGCGAGCGTTCAGTGGATGCTAATGAGTTAGTAGAGACTGAAGACTTGGAGAAAAACGGTGAAATTGATAGTAATTCAAAAGATAATGGAAATTATGAGGCTGAAATCGTTGATGGTGAGCTGTTGGGCGGGCAGACGATGTCGCCGTCGAATTCTCCGTCGCCGTTACCGGCGACTAAAGGGAGAGGGTTAAGGAAATGGCGGAGGATTCGTAGAGAAGCTGGTAAGGAAACGAATAGTAGTTTAGA...

CDS

Download CDS FASTA

1476 bp · LXL04_037236|LXL04_037236|OH1004|CDS

ATGGATTTGGGAAGCGAGCGTTCAGTGGATGCTAATGAGTTAGTAGAGACTGAAGACTTGGAGAAAAACGGTGAAATTGATAGTAATTCAAAAGATAATGGAAATTATGAGGCTGAAATCGTTGATGGTGAGCTGTTGGGCGGGCAGACGATGTCGCCGTCGAATTCTCCGTCGCCGTTACCGGCGACTAAAGGGAGAGGGTTAAGGAAATGGCGGAGGATTCGTAGAGAAGCTGGTAAGGAAACGAATAGTAGTTTAGA...

Protein

Download Protein FASTA

491 aa · LXL04_037236|LXL04_037236|OH1004|PROTEIN

MDLGSERSVDANELVETEDLEKNGEIDSNSKDNGNYEAEIVDGELLGGQTMSPSNSPSPLPATKGRGLRKWRRIRREAGKETNSSLDSNRKRGMIALPVTTKQRNEGSSSSTNAISHPLDHNLLYGDLVRGSDFASRADSDNSEDRNSTAASDPKPNRNKIHVKPSLNGKNPGVSVQEQEQRDDDQQEKSQSQNQNQTKKARGGVKLKKENSISSMESDSRSSNFIFTQGSNSVTSNGRKNGRLVNYEEEDYSDDAQNGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037236`
TK1151 ID	TkA04G262850
OH-1004 ID	LXL04_037236
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 98.333 / OH-1004 48.065 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037236

Location Chr09:3837766-3844045 (+)

Description Similar to WIP2: WPP domain-interacting protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56210`	Mediates and enhances the nuclear envelope docking of RANGAP proteins mediated by WIT1 and WIT2 in the undifferentiated cells of root tips.	No verified direct reference in this release
`At3g13360`	Mediates and enhances the nuclear envelope docking of RANGAP proteins mediated by WIT1 and WIT2 in the undifferentiated cells of root tips.	No verified direct reference in this release
`At4g26455`	Mediates and enhances the nuclear envelope docking of RANGAP proteins mediated by WIT1 and WIT2 in the undifferentiated cells of root tips.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037236 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006997 nucleus organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0009504 cell plate Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0042803 protein homodimerization activity Molecular Function

GO:0046982 protein heterodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT3G13360

ath:AT4G26455

ath:AT5G56210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.338

Rank 1 · LXL04_037236 · OH-1004

Endoplasmic reticulum0.202

Rank 2 · LXL04_037236 · OH-1004

Cytoplasm0.200

Rank 3 · LXL04_037236 · OH-1004

Cell membrane0.143

Rank 4 · LXL04_037236 · OH-1004

Golgi apparatus0.099

Rank 5 · LXL04_037236 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28487.1WIP_coiled_coil329-396 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037236	`PF28487.1`	WIP_coiled_coil	329	396	1.1e-07	32.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FH18`	Arabidopsis thaliana	WPP domain-interacting protein 2	28.230%	Swiss-Prot	weak database homology
`Q94AV5`	Arabidopsis thaliana	WPP domain-interacting protein 3	28.604%	Swiss-Prot	weak database homology
`Q8GXA4`	Arabidopsis thaliana	WPP domain-interacting protein 1	27.719%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card