RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_037227
Reference: OH-1004 Chr: Chr09 Coordinates: 3577899-3581310 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1929 bp · LXL04_037227|LXL04_037227|OH1004|cDNA

ATGCCTCCAAGCCCTAGCCCACGATCTCTTTTCGCATCCATGTTAGGCGAAGACCCTGGTTCACGATCAGTACCCGATTCTCAAAAACACGACACGGGGTTCACCTTCGATCAACAAATTAGGTCTGAAAACGATGACGCGACAAAATCAAGTGAGTTTATCGATCAGAAATCAAGCTCGAGGGCAGGTCTGGTTGAAAGAATGGCGGCAAGGGCGGGTCATAATGCTCCTAGGTTAAATACCGAGATTATAAAATCTTC...

CDS

Download CDS FASTA

1929 bp · LXL04_037227|LXL04_037227|OH1004|CDS

ATGCCTCCAAGCCCTAGCCCACGATCTCTTTTCGCATCCATGTTAGGCGAAGACCCTGGTTCACGATCAGTACCCGATTCTCAAAAACACGACACGGGGTTCACCTTCGATCAACAAATTAGGTCTGAAAACGATGACGCGACAAAATCAAGTGAGTTTATCGATCAGAAATCAAGCTCGAGGGCAGGTCTGGTTGAAAGAATGGCGGCAAGGGCGGGTCATAATGCTCCTAGGTTAAATACCGAGATTATAAAATCTTC...

Protein

Download Protein FASTA

642 aa · LXL04_037227|LXL04_037227|OH1004|PROTEIN

MPPSPSPRSLFASMLGEDPGSRSVPDSQKHDTGFTFDQQIRSENDDATKSSEFIDQKSSSRAGLVERMAARAGHNAPRLNTEIIKSSDNNSSQNQQTQLPFVSFSPGVSPSSFLESPIFLSNSLVQPSPTTGKFQFGPNGNDNGNGRSSMMFLESSDRIKDNFFQENNNNNNTSFAFKPFPDSASVPRDHVNPPFMSTQSFQTQETLPQSERQFPPHKIEPNQEPQQHNHNHDDDTSDQRTNGEIGNSNNSSSEDGYNWR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_037227
TK1151 IDTkA04G258590
OH-1004 IDLXL04_037227
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)86.200
Protein coverage (%)TK1151 92.199 / OH-1004 45.016
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_037227
LocationChr09:3577899-3581310 (+)
DescriptionSimilar to WRKY2: Probable WRKY transcription factor 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g56270 Transcription factor.
Transcriptional activation of Arabidopsis axis patterning genes WOX8/9 links zygote polarity to embryo development.2011 · DOI: 10.1016/j.devcel.2011.01.009
At4g26440 Transcription factor. No verified direct reference in this release
At4g26640 Transcription factor. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: Q6B6R4 Transcription repressor (By similarity). No verified direct reference in this release
Os01g0826400 May participate in transcriptional regulation of abscisic acid and gibberellin signaling.
Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells.2005 · DOI: 10.1104/pp.104.054312
A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.2009 · DOI: 10.1007/s11103-009-9463-4
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_037227 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009409 response to cold Biological Process
GO:0009555 pollen development Biological Process
GO:0009611 response to wounding Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009739 response to gibberellin Biological Process
GO:0009740 gibberellic acid mediated signaling pathway Biological Process
GO:0009753 response to jasmonic acid Biological Process
GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process
GO:0009846 pollen germination Biological Process
KEGG gene cross-reference
ath:AT4G26440
ath:AT4G26640
ath:AT5G56270
dosa:Os01g0826400
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.964
Rank 1 · LXL04_037227 · OH-1004
Cytoplasm0.164
Rank 2 · LXL04_037227 · OH-1004
Mitochondrion0.014
Rank 3 · LXL04_037227 · OH-1004
Cell membrane0.012
Rank 4 · LXL04_037227 · OH-1004
Endoplasmic reticulum0.006
Rank 5 · LXL04_037227 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106.22WRKY254-310 aa
PF03106.22WRKY446-503 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_037227PF03106.22WRKY2543101.9e-52176.0
LXL04_037227PF03106.22WRKY4465031.9e-52176.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FG77Arabidopsis thalianaProbable WRKY transcription factor 245.557%Swiss-Protmoderate database homology
O65590Arabidopsis thalianaProbable WRKY transcription factor 3448.734%Swiss-Protmoderate database homology
Q93WV0Arabidopsis thalianaProbable WRKY transcription factor 2043.936%Swiss-Protmoderate database homology
Q6B6R4Oryza sativa subsp. indicaWRKY transcription factor WRKY2443.468%Swiss-Protmoderate database homology
Q6IEQ7Oryza sativa subsp. japonicaWRKY transcription factor WRKY2443.230%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser