LXL04_037219 | RubberDandelionOmics

Gene overview

LXL04_037219

Reference: OH-1004 Chr: Chr09 Coordinates: 3147857-3151609 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1470 bp · LXL04_037219|LXL04_037219|OH1004|cDNA

ATGGGTGCCTGTTATTCCACCGCCGGCAACGGCCGGAGAGACAGAGAAGACGGTGGCGGCGGTAGTAAGGGCAATCGTAAATCCACTGATTTCAAGTTCAAGCTTGGTGGCGGCGGCGGCCGCCGAAGGAGTGCTGCGGCGGAGGAACGCGCCCTCCACCAGGTTCCCGGTAGGCTTTTCGGCAATGGGTCTTGCAGTATCGCTAGTTTATACACGCAACAGGGCAAGAAAGGGACGAATCAAGACGCCATGATCGTTTG...

CDS

Download CDS FASTA

1470 bp · LXL04_037219|LXL04_037219|OH1004|CDS

ATGGGTGCCTGTTATTCCACCGCCGGCAACGGCCGGAGAGACAGAGAAGACGGTGGCGGCGGTAGTAAGGGCAATCGTAAATCCACTGATTTCAAGTTCAAGCTTGGTGGCGGCGGCGGCCGCCGAAGGAGTGCTGCGGCGGAGGAACGCGCCCTCCACCAGGTTCCCGGTAGGCTTTTCGGCAATGGGTCTTGCAGTATCGCTAGTTTATACACGCAACAGGGCAAGAAAGGGACGAATCAAGACGCCATGATCGTTTG...

Protein

Download Protein FASTA

489 aa · LXL04_037219|LXL04_037219|OH1004|PROTEIN

MGACYSTAGNGRRDREDGGGGSKGNRKSTDFKFKLGGGGGRRRSAAAEERALHQVPGRLFGNGSCSIASLYTQQGKKGTNQDAMIVWENFNSTNDAVFCGVFDGHGPYGHMVARKVRDSLPVLLSTNWTTSSDNNNDNNNNVNGSLHEEEEEEEEEEKENWCEELEVGEKEKEQVPEKYFPLKKSILKAFSLMDMELKTHPSIDCFCSGSTAVALVKQGQDLIIGNLGDSRAVMASKDDNNGLVAVQLTVDLKPNLPREA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037219`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037219

Location Chr09:3147857-3151609 (+)

Description Similar to At1g16220: Probable protein phosphatase 2C 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16220`	Probable protein phosphatase 2C 6.	No verified direct reference in this release
`At1g79630`	Probable protein phosphatase 2C 18.	No verified direct reference in this release
`At3g02750`	Probable protein phosphatase 2C 33.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0500300`	Probable protein phosphatase 2C 66.	No verified direct reference in this release
`Os02g0471500`	Probable protein phosphatase 2C 14.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037219 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G16220

ath:AT1G79630

ath:AT3G02750

dosa:Os02g0471500

dosa:Os08g0500300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.369

Rank 1 · LXL04_037219 · OH-1004

Cell membrane0.364

Rank 2 · LXL04_037219 · OH-1004

Nucleus0.329

Rank 3 · LXL04_037219 · OH-1004

Endoplasmic reticulum0.078

Rank 4 · LXL04_037219 · OH-1004

Golgi apparatus0.057

Rank 5 · LXL04_037219 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C134-363 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037219	`PF00481.27`	PP2C	134	363	6.9e-43	147.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SA22`	Arabidopsis thaliana	Probable protein phosphatase 2C 6	60.579%	Swiss-Prot	strong database homology
`Q8RXZ4`	Arabidopsis thaliana	Probable protein phosphatase 2C 18	54.420%	Swiss-Prot	strong database homology
`Q9M8R7`	Arabidopsis thaliana	Probable protein phosphatase 2C 33	54.148%	Swiss-Prot	strong database homology
`Q6ZKL8`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 66	60.127%	Swiss-Prot	strong database homology
`Q6K6N7`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 14	49.782%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card