LXL04_037053 | RubberDandelionOmics

Gene overview

LXL04_037053

Reference: OH-1004 Chr: Chr08 Coordinates: 52416823-52417633 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

507 bp · LXL04_037053|LXL04_037053|OH1004|cDNA

ATGGCGGCAACGACGAATTCCAAACCGGTGATGATTGTCGGAGTTGACGATAGCGAGCAGAGCTTTTTCGCACTGGAATGGACACTGGATCAGTTCTTTGTACCCTCTGCTCCAAATCCTCTCTTCGAGCTAATCATCGTTAACAGCAAACCTACTCCTCCTTCGTCCATAGGATTCGCCGTACCAGGTGTGGAAGTTTTATCGCATGTAGCTGTGGATTTGAAGAACATCGCTACCAGAGTTATCGATAGGGCAAGGGA...

CDS

Download CDS FASTA

507 bp · LXL04_037053|LXL04_037053|OH1004|CDS

ATGGCGGCAACGACGAATTCCAAACCGGTGATGATTGTCGGAGTTGACGATAGCGAGCAGAGCTTTTTCGCACTGGAATGGACACTGGATCAGTTCTTTGTACCCTCTGCTCCAAATCCTCTCTTCGAGCTAATCATCGTTAACAGCAAACCTACTCCTCCTTCGTCCATAGGATTCGCCGTACCAGGTGTGGAAGTTTTATCGCATGTAGCTGTGGATTTGAAGAACATCGCTACCAGAGTTATCGATAGGGCAAGGGA...

Protein

Download Protein FASTA

168 aa · LXL04_037053|LXL04_037053|OH1004|PROTEIN

MAATTNSKPVMIVGVDDSEQSFFALEWTLDQFFVPSAPNPLFELIIVNSKPTPPSSIGFAVPGVEVLSHVAVDLKNIATRVIDRAREICISKSVNDATLEVVEGDARNILCDAVERYHATILVVGSHGYGAIKRAVLGSVSDYVAHHARCTVMVVKKPKAKHEDANHH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037053`
TK1151 ID	TkA04G007670
OH-1004 ID	LXL04_037053
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037053

Location Chr08:52416823-52417633 (-)

Description Similar to Rv2026c: Universal stress protein Rv2026c (Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01520`	Universal stress protein A-like protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037053 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016208 AMP binding Molecular Function

KEGG gene cross-reference

ath:AT3G01520

mja:MJ_0531

mtc:MT2085

mtu:Rv2026c

mtv:RVBD_2026c

syn:slr1101

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.484

Rank 1 · LXL04_037053 · OH-1004

Cell membrane0.333

Rank 2 · LXL04_037053 · OH-1004

Nucleus0.245

Rank 3 · LXL04_037053 · OH-1004

Lysosome / Vacuole0.104

Rank 4 · LXL04_037053 · OH-1004

Endoplasmic reticulum0.063

Rank 5 · LXL04_037053 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00582.33Usp11-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037053	`PF00582.33`	Usp	11	156	1.7e-22	81.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LGG8`	Arabidopsis thaliana	Universal stress protein A-like protein	38.889%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card