LXL04_037019 | RubberDandelionOmics

Gene overview

LXL04_037019

Reference: OH-1004 Chr: Chr08 Coordinates: 51780499-51792744 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3474 bp · LXL04_037019|LXL04_037019|OH1004|cDNA

atgagttctaggTTTTGTGATCCTTCAAACAAAATCTGTCATAAGTGTAGTGAGTTTATCTACGAAATTACtaaaaaagagagaaaaagagtggGAAATGATCGGGTAAAAGCCGCTTTCTCTAAAGACAGGATACAAATGGCTGTACGGTGTAACCGTGTAGATCACGACGCCATGGAAGACGAACCTGATGTTTCTGATCAGCTCATTCGCCGCTCGAAAAGGACTAGGGTTCAGGCGAGGACTTTCGATGGGCTAGT...

CDS

Download CDS FASTA

3474 bp · LXL04_037019|LXL04_037019|OH1004|CDS

ATGAGTTCTAGGTTTTGTGATCCTTCAAACAAAATCTGTCATAAGTGTAGTGAGTTTATCTACGAAATTACTAAAAAAGAGAGAAAAAGAGTGGGAAATGATCGGGTAAAAGCCGCTTTCTCTAAAGACAGGATACAAATGGCTGTACGGTGTAACCGTGTAGATCACGACGCCATGGAAGACGAACCTGATGTTTCTGATCAGCTCATTCGCCGCTCGAAAAGGACTAGGGTTCAGGCGAGGACTTTCGATGGGCTAGT...

Protein

Download Protein FASTA

1157 aa · LXL04_037019|LXL04_037019|OH1004|PROTEIN

MSSRFCDPSNKICHKCSEFIYEITKKERKRVGNDRVKAAFSKDRIQMAVRCNRVDHDAMEDEPDVSDQLIRRSKRTRVQARTFDGLVSNLKDIVESEDESADEFVEPRRKPNRPRTAEAAPSTTTAKAFDQNLIEVIKSNGKFIPQVVKSWVERYETDPKPAMVELLTMLFETCGATYHIQGEFLDETNVDDVVVALVNLAAQGRVEDYQNSKKKEFRSFKENLVSFWDNLVSECQNGPFTPPRVYRHVASMVGLQLVTS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037019`
TK1151 ID	TkA04G010440
OH-1004 ID	LXL04_037019
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.400
Protein coverage (%)	TK1151 100.000 / OH-1004 94.987 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037019

Location Chr08:51780499-51792744 (-)

Description Similar to SCC3: Sister-chromatid cohesion protein 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g47980`	Essential component of cohesin complex, a complex required for the cohesion of sister chromatids after DNA replication.	AtREC8 and AtSCC3 are essential to the monopolar orientation of the kinetochores during meiosis.2005 · DOI: 10.1242/jcs.02583 Cohesin gene defects may impair sister chromatid alignment and genome stability in Arabidopsis thaliana.2009 · DOI: 10.1007/s00412-009-0220-x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037019 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000278 mitotic cell cycle Biological Process

GO:0007062 sister chromatid cohesion Biological Process

GO:0007065 male meiosis sister chromatid cohesion Biological Process

GO:0007066 female meiosis sister chromatid cohesion Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0007130 synaptonemal complex assembly Biological Process

GO:0034087 establishment of mitotic sister chromatid cohesion Biological Process

GO:0034089 establishment of meiotic sister chromatid cohesion Biological Process

GO:0034502 protein localization to chromosome Biological Process

GO:0051301 cell division Biological Process

GO:0051455 spindle attachment to meiosis I kinetochore Biological Process

GO:0051754 meiotic sister chromatid cohesion, centromeric Biological Process

KEGG gene cross-reference

ath:AT2G47980

hsa:10274

hsa:10734

mmu:20842

mmu:50878

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.926

Rank 1 · LXL04_037019 · OH-1004

Cytoplasm0.172

Rank 2 · LXL04_037019 · OH-1004

Mitochondrion0.019

Rank 3 · LXL04_037019 · OH-1004

Cell membrane0.018

Rank 4 · LXL04_037019 · OH-1004

Golgi apparatus0.010

Rank 5 · LXL04_037019 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08514.18STAG208-297 aa

PF21581.4SCD326-399 aa

PF24571.3HEAT_SCC3-SA504-788 aa

PF31007.1STAG_C948-1067 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037019	`PF08514.18`	STAG	208	297	5.9e-15	55.9
LXL04_037019	`PF21581.4`	SCD	326	399	2.8e-30	105.1
LXL04_037019	`PF24571.3`	HEAT_SCC3-SA	504	788	1.7e-68	232.1
LXL04_037019	`PF31007.1`	STAG_C	948	1067	3.2e-19	69.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82265`	Arabidopsis thaliana	Sister-chromatid cohesion protein 3	54.463%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card