LXL04_036955 | RubberDandelionOmics

Gene overview

LXL04_036955

Reference: OH-1004 Chr: Chr08 Coordinates: 50857024-50858055 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1032 bp · LXL04_036955|LXL04_036955|OH1004|cDNA

ATGCCTGAACTCATTGAAGGTCTCCCTGATGCTGTAGCTATAAGATGTCTTGCGCGGGTCCCATACCGGCTTTTCCCAAAACTAGAAACCGTTTGTCATTCATGGAGGGATGCAATTCGCAGCAATGAACTAGTCAAAGCCCGTGAAGAAGTCAACTCAACCGAAGACTTTTTATGTGTATCCGCATTTGACCCCGAAAACATCTGGCAAATCTTCGATCCAAATCGTGCAATTTGGATCACTCTCCCTATCCTTCCATC...

CDS

Download CDS FASTA

1032 bp · LXL04_036955|LXL04_036955|OH1004|CDS

ATGCCTGAACTCATTGAAGGTCTCCCTGATGCTGTAGCTATAAGATGTCTTGCGCGGGTCCCATACCGGCTTTTCCCAAAACTAGAAACCGTTTGTCATTCATGGAGGGATGCAATTCGCAGCAATGAACTAGTCAAAGCCCGTGAAGAAGTCAACTCAACCGAAGACTTTTTATGTGTATCCGCATTTGACCCCGAAAACATCTGGCAAATCTTCGATCCAAATCGTGCAATTTGGATCACTCTCCCTATCCTTCCATC...

Protein

Download Protein FASTA

343 aa · LXL04_036955|LXL04_036955|OH1004|PROTEIN

MPELIEGLPDAVAIRCLARVPYRLFPKLETVCHSWRDAIRSNELVKAREEVNSTEDFLCVSAFDPENIWQIFDPNRAIWITLPILPSKVKNLTNFGVVSTAGKLFVLGGGSDAVDPLTGDQDGSFATNEVWAYDPVLRRWSSRAAMVVPRAMFACCVVNGKILVAGGFTTCRKSIARSELYDPETDTWAPIPDLNYTHNSACSGVVLGGEVHVVHKGLTTVQVLKKDMWWVHEHAWVHGPMTVVNGSLYVMTHGVIYKQE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036955`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036955

Location Chr08:50857024-50858055 (+)

Description Similar to SKIP30: F-box/kelch-repeat protein SKIP30

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63220`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At1g67480`	F-box/kelch-repeat protein At1g67480.	No verified direct reference in this release
`At1g55270`	F-box/kelch-repeat protein At1g55270.	No verified direct reference in this release
`At1g27420`	Putative F-box/kelch-repeat protein At1g27420.	No verified direct reference in this release
`At1g16250`	F-box/kelch-repeat protein At1g16250.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036955 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:2000762 regulation of phenylpropanoid metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G16250

ath:AT1G27420

ath:AT1G55270

ath:AT1G67480

ath:AT3G63220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.471

Rank 1 · LXL04_036955 · OH-1004

Nucleus0.456

Rank 2 · LXL04_036955 · OH-1004

Cell membrane0.097

Rank 3 · LXL04_036955 · OH-1004

Endoplasmic reticulum0.062

Rank 4 · LXL04_036955 · OH-1004

Plastid0.045

Rank 5 · LXL04_036955 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24681.2Kelch_KLHDC2_KLHL20_DRC770-194 aa

PF13415.13Beta-prop_FBX4272-232 aa

PF24981.2Beta-prop_ATRN-LZTR172-191 aa

PF13964.13Beta-prop_Calicin78-197 aa

PF01344.32Kelch_193-146 aa

PF13964.13Beta-prop_Calicin119-211 aa

PF25210.2Kelch_FKB95126-273 aa

PF01344.32Kelch_1149-195 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036955	`PF24681.2`	Kelch_KLHDC2_KLHL20_DRC7	70	194	9.9e-11	42.1
LXL04_036955	`PF13415.13`	Beta-prop_FBX42	72	232	1.4e-10	41.9
LXL04_036955	`PF24981.2`	Beta-prop_ATRN-LZTR1	72	191	7.1e-08	32.8
LXL04_036955	`PF13964.13`	Beta-prop_Calicin	78	197	1.6e-13	51.1
LXL04_036955	`PF01344.32`	Kelch_1	93	146	2.9e-21	75.3
LXL04_036955	`PF13964.13`	Beta-prop_Calicin	119	211	1.6e-13	51.1
LXL04_036955	`PF25210.2`	Kelch_FKB95	126	273	1.8e-18	67.8
LXL04_036955	`PF01344.32`	Kelch_1	149	195	2.9e-21	75.3
LXL04_036955	`PF07646.22`	Kelch_2	150	194	1.6e-14	53.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1W7`	Arabidopsis thaliana	F-box/kelch-repeat protein SKIP30	61.449%	Swiss-Prot	strong database homology
`Q9CAG8`	Arabidopsis thaliana	F-box/kelch-repeat protein At1g67480	35.514%	Swiss-Prot	moderate database homology
`Q93W93`	Arabidopsis thaliana	F-box/kelch-repeat protein At1g55270	29.008%	Swiss-Prot	weak database homology
`Q9FZJ3`	Arabidopsis thaliana	Putative F-box/kelch-repeat protein At1g27420	31.217%	Swiss-Prot	moderate database homology
`Q0WW40`	Arabidopsis thaliana	F-box/kelch-repeat protein At1g16250	25.532%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card