LXL04_036919 | RubberDandelionOmics

Gene overview

LXL04_036919

Reference: OH-1004 Chr: Chr08 Coordinates: 50067563-50070835 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1788 bp · LXL04_036919|LXL04_036919|OH1004|cDNA

ATGCACGGACACCAGCCTCATCCGGTCACTCCAGGCGGAGCTAGATACCTCTCCGATGATTTCCTTTCTAAACGAGGAAAGCAACGCGGTAGCTACAACTGTGGCCGGTGTGGTCTTCCGAAGAAAGGCCATGTCTGTCACCTACCAGCTCCGTCGACTGCCGATTCGAACTCGGCGGCTGTAACTCCGACAGATTCAGCAACCTCATCCGCCGCCGCCACTATTCCGGCCTCGCCTCCGGTATCCGTTGCTCGTCCGCA...

CDS

Download CDS FASTA

1788 bp · LXL04_036919|LXL04_036919|OH1004|CDS

ATGCACGGACACCAGCCTCATCCGGTCACTCCAGGCGGAGCTAGATACCTCTCCGATGATTTCCTTTCTAAACGAGGAAAGCAACGCGGTAGCTACAACTGTGGCCGGTGTGGTCTTCCGAAGAAAGGCCATGTCTGTCACCTACCAGCTCCGTCGACTGCCGATTCGAACTCGGCGGCTGTAACTCCGACAGATTCAGCAACCTCATCCGCCGCCGCCACTATTCCGGCCTCGCCTCCGGTATCCGTTGCTCGTCCGCA...

Protein

Download Protein FASTA

595 aa · LXL04_036919|LXL04_036919|OH1004|PROTEIN

MHGHQPHPVTPGGARYLSDDFLSKRGKQRGSYNCGRCGLPKKGHVCHLPAPSTADSNSAAVTPTDSATSSAAATIPASPPVSVARPHRRQQRCSNLRRALSFDDVDAYEVPEDEDEGGDECVSPDVEFGSGSGKLPMNCLWEVLRRLPPPSLLSAAKVCRGWLDVSRRLWKAAEELRLRVPAKTQVGFVGSVLQKCPALVRLSLTMESDMDSTMLACIAFSCPNLESLEIFTCEGSFNRITGDELGRFVADKRCLKSLKM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036919`
TK1151 ID	TkA04G017590
OH-1004 ID	LXL04_036919
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036919

Location Chr08:50067563-50070835 (+)

Description Similar to FBL17: F-box/LRR-repeat protein 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g54650`	Essential protein for male fertility.	Control of plant germline proliferation by SCF(FBL17) degradation of cell cycle inhibitors.2008 · DOI: 10.1038/nature07289

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036919 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000077 DNA damage checkpoint signaling Biological Process

GO:0000086 G2/M transition of mitotic cell cycle Biological Process

GO:0000209 protein polyubiquitination Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009555 pollen development Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0048316 seed development Biological Process

GO:0051301 cell division Biological Process

KEGG gene cross-reference

ath:AT3G54650

bta:511007

hsa:84961

mmu:448987

mmu:72194

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.936

Rank 1 · LXL04_036919 · OH-1004

Cytoplasm0.094

Rank 2 · LXL04_036919 · OH-1004

Cell membrane0.036

Rank 3 · LXL04_036919 · OH-1004

Plastid0.022

Rank 4 · LXL04_036919 · OH-1004

Endoplasmic reticulum0.021

Rank 5 · LXL04_036919 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937.13F-box-like134-171 aa

PF00646.39F-box134-169 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036919	`PF12937.13`	F-box-like	134	171	1.3e-06	28.8
LXL04_036919	`PF00646.39`	F-box	134	169	1.4e-06	28.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W104`	Arabidopsis thaliana	F-box/LRR-repeat protein 17	57.930%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card