LXL04_036859 | RubberDandelionOmics

Gene overview

LXL04_036859

Reference: OH-1004 Chr: Chr08 Coordinates: 49201707-49206802 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3558 bp · LXL04_036859|LXL04_036859|OH1004|cDNA

atgaaagaagaagaagaagaagatagaGCTCTGTTAAGTAGTCTGGGCGTCACATCAGCAAACCCAGAAGAAATCGAACTTGATATACTAGAAGAGGCAAGAAACCAAGTGGAAGGAACCACAGATGATGAACATCTTGAAAGAAGAAAAACTAATGAACCATCATCAACAACTCGAACAGATGTTATTAATAAATTAAGAGCCATAAATGTTGAAATAGATGCAGTTGCATGTACAGTTGAAGATGTTAAGAACTTTTC...

CDS

Download CDS FASTA

3558 bp · LXL04_036859|LXL04_036859|OH1004|CDS

ATGAAAGAAGAAGAAGAAGAAGATAGAGCTCTGTTAAGTAGTCTGGGCGTCACATCAGCAAACCCAGAAGAAATCGAACTTGATATACTAGAAGAGGCAAGAAACCAAGTGGAAGGAACCACAGATGATGAACATCTTGAAAGAAGAAAAACTAATGAACCATCATCAACAACTCGAACAGATGTTATTAATAAATTAAGAGCCATAAATGTTGAAATAGATGCAGTTGCATGTACAGTTGAAGATGTTAAGAACTTTTC...

Protein

Download Protein FASTA

1185 aa · LXL04_036859|LXL04_036859|OH1004|PROTEIN

MKEEEEEDRALLSSLGVTSANPEEIELDILEEARNQVEGTTDDEHLERRKTNEPSSTTRTDVINKLRAINVEIDAVACTVEDVKNFSRTEEHTHSDDNDNENGEKSIMQGSSNDLNLQHALATDRLESLKRTKAQLEKQFEHLGNESNKGISVNNKHEKLLKSLVQEEPNHKRKQKEVESKNKKQKKKHKTVAFNDDDDFDAVLNAASAGFVETERDELVRKGILTPFHNLKGYERRIEEDNHNNNDNYNDLPSTSIARA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036859`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036859

Location Chr08:49201707-49206802 (+)

Description Similar to CHR8: Protein CHROMATIN REMODELING 8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g18760`	Essential factor involved in transcription-coupled nucleotide excision repair (TCR) which allows RNA polymerase II-blocking lesions to be rapidly removed from the transcribed strand of active genes.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0102800`	Essential factor involved in transcription-coupled nucleotide excision repair (TCR) which allows RNA polymerase II-blocking lesions to be rapidly removed from the transcribed strand of active genes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036859 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000012 single strand break repair Biological Process

GO:0000077 DNA damage checkpoint signaling Biological Process

GO:0006281 DNA repair Biological Process

GO:0006283 transcription-coupled nucleotide-excision repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006974 DNA damage response Biological Process

GO:0006979 response to oxidative stress Biological Process

KEGG gene cross-reference

ath:AT2G18760

dosa:Os01g0102800

hsa:2074

osa:4326441

sce:YJR035W

spo:2539473

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.938

Rank 1 · LXL04_036859 · OH-1004

Cytoplasm0.112

Rank 2 · LXL04_036859 · OH-1004

Mitochondrion0.020

Rank 3 · LXL04_036859 · OH-1004

Cell membrane0.018

Rank 4 · LXL04_036859 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_036859 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851.22ResIII383-585 aa

PF00176.30SNF2-rel_dom387-716 aa

PF00271.38Helicase_C736-848 aa

PF25875.1WHD_Rad26_CSB1122-1185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036859	`PF04851.22`	ResIII	383	585	8.2e-06	26.5
LXL04_036859	`PF00176.30`	SNF2-rel_dom	387	716	3.2e-75	253.6
LXL04_036859	`PF00271.38`	Helicase_C	736	848	7e-24	84.9
LXL04_036859	`PF25875.1`	WHD_Rad26_CSB	1122	1185	5.9e-14	52.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZV43`	Arabidopsis thaliana	Protein CHROMATIN REMODELING 8	63.577%	Swiss-Prot	strong database homology
`Q7F2E4`	Oryza sativa subsp. japonica	DNA excision repair protein CSB	60.743%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card