LXL04_036856 | RubberDandelionOmics

Gene overview

LXL04_036856

Reference: OH-1004 Chr: Chr08 Coordinates: 49189778-49193626 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1638 bp · LXL04_036856|LXL04_036856|OH1004|cDNA

ATGGATTCAGCAAGGAGCTGGCTACATAAATTTCAACCAAGAGACCGATTAAGGTCAAATACCAGAAGGAGAGATTCAATGGGTGGTGGTGAAGATGACATTTCAGGTGAAGAGGCATCAAATATCACAAAGCAAAAGGTCGCTGCAGCCAAAAAGTACATTGAAAACCATTACAAGGAACAAATGAAGAATCTACAGGAAAGGAAAGAACGGCGAATTTTACTTGAGAAGAAACTGGCTGACGCTGACGTGTCAGAGGA...

CDS

Download CDS FASTA

1638 bp · LXL04_036856|LXL04_036856|OH1004|CDS

ATGGATTCAGCAAGGAGCTGGCTACATAAATTTCAACCAAGAGACCGATTAAGGTCAAATACCAGAAGGAGAGATTCAATGGGTGGTGGTGAAGATGACATTTCAGGTGAAGAGGCATCAAATATCACAAAGCAAAAGGTCGCTGCAGCCAAAAAGTACATTGAAAACCATTACAAGGAACAAATGAAGAATCTACAGGAAAGGAAAGAACGGCGAATTTTACTTGAGAAGAAACTGGCTGACGCTGACGTGTCAGAGGA...

Protein

Download Protein FASTA

545 aa · LXL04_036856|LXL04_036856|OH1004|PROTEIN

MDSARSWLHKFQPRDRLRSNTRRRDSMGGGEDDISGEEASNITKQKVAAAKKYIENHYKEQMKNLQERKERRILLEKKLADADVSEEDQNNLLKFLEKKETEYMRLKRHKMGADDFELLTMIGKGAFGEVRVCREKTTGSVFAMKKLKKSEMLRRGQVEHVRAERNLLAEVDSNCIVKLYCSFQDDEYLYLIMEYLPGGDMMTLLMRKDTLTEDEARFYVAETVLAIESIHKHNYVHRDIKPDNLLLDRYGHLRLSDFGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036856`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_036856`
Location	Chr08:49189778-49193626 (-)
Description	Similar to CBK1: Serine/threonine-protein kinase CBK1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036856` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000920 septum digestion after cytokinesis Biological Process GO:0006468 protein phosphorylation Biological Process GO:0007118 budding cell apical bud growth Biological Process GO:0007163 establishment or maintenance of cell polarity Biological Process GO:0007165 signal transduction Biological Process GO:0010507 negative regulation of autophagy Biological Process GO:0018105 peptidyl-serine phosphorylation Biological Process GO:0030866 cortical actin cytoskeleton organization Biological Process GO:0030950 establishment or maintenance of actin cytoskeleton polarity Biological Process GO:0031032 actomyosin structure organization Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0045921 positive regulation of exocytosis Biological Process
KEGG gene cross-reference	ddi:DDB_G0278457 dme:Dmel_CG8637 dpo:4813412 hsa:23012 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.595

Rank 1 · LXL04_036856 · OH-1004

Nucleus0.448

Rank 2 · LXL04_036856 · OH-1004

Cell membrane0.130

Rank 3 · LXL04_036856 · OH-1004

Mitochondrion0.044

Rank 4 · LXL04_036856 · OH-1004

Endoplasmic reticulum0.033

Rank 5 · LXL04_036856 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase117-268 aa

PF07714.24PK_Tyr_Ser-Thr117-264 aa

PF03109.23ABC1190-266 aa

PF00069.32Pkinase312-415 aa

PF07714.24PK_Tyr_Ser-Thr318-381 aa

PF00433.30Pkinase_C434-478 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036856	`PF00069.32`	Pkinase	117	268	3.2e-65	220.9
LXL04_036856	`PF07714.24`	PK_Tyr_Ser-Thr	117	264	7.1e-29	101.6
LXL04_036856	`PF03109.23`	ABC1	190	266	7e-06	26.1
LXL04_036856	`PF00069.32`	Pkinase	312	415	3.2e-65	220.9
LXL04_036856	`PF07714.24`	PK_Tyr_Ser-Thr	318	381	7.1e-29	101.6
LXL04_036856	`PF00433.30`	Pkinase_C	434	478	1.3e-08	36.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card