LXL04_036828 | RubberDandelionOmics

Gene overview

LXL04_036828

Reference: OH-1004 Chr: Chr08 Coordinates: 48898333-48903011 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3239 bp · LXL04_036828|LXL04_036828|OH1004|cDNA

ACCTTTAAACAACAATCAAAACTTCTCTTCTAATCAAACCTTAGACCCCCCAACCATCAGTTGGTAGACTTACCCATACACACATATCCCCTTCAAAACCCCCTACTCTCATTCTCCACCATCACATTCACACTCATTCTTTCTTTCTTGCTGCCATGGCTGCCCTCTTTACAGGCTCCCATGGCCACCATGATCTTCCGGATCATGATACCCAATCGAATATATGTCGGGTATGCAGTGATGAGATTAGCCAACAGTTT...

CDS

Download CDS FASTA

3084 bp · LXL04_036828|LXL04_036828|OH1004|CDS

ATGGCTGCCCTCTTTACAGGCTCCCATGGCCACCATGATCTTCCGGATCATGATACCCAATCGAATATATGTCGGGTATGCAGTGATGAGATTAGCCAACAGTTTGTTGCTTGTCGCGAATGCAAGTTCCCAGTGTGTCGGCCTTGTTACATTTATGAACGAAGCGAAGGGAACCAATGCTGCCCTCAATGCAACGTTCGATATAAACGTCACAAAGGTTGTCCACGAGTTGTTGGAGATGATGAAGAAAGTGACGATGG...

Protein

Download Protein FASTA

1027 aa · LXL04_036828|LXL04_036828|OH1004|PROTEIN

MAALFTGSHGHHDLPDHDTQSNICRVCSDEISQQFVACRECKFPVCRPCYIYERSEGNQCCPQCNVRYKRHKGCPRVVGDDEESDDGDDFEDEFQMKDRQEAQDRNRVDNQSENGDSHPPKQYNTNGFAFSSAGSVAGRDLDRDRDDEWKDRVEKWKTRQEKRGLVTKGDDANDPGEEDDYLMAEARQPLWRKVPISSSLINPYRIVIVLRLVILIFFFRFRIMTPAYDAYPLWLISVICEIWFALSWILDQFPKWFPIN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036828`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036828

Location Chr08:48898333-48903011 (+)

Description Similar to CESA4: Cellulose synthase A catalytic subunit 4 [UDP-forming]

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44030`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance.2007 · DOI: 10.1105/tpc.106.048058

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0467800`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation (By similarity).	Three distinct rice cellulose synthase catalytic subunit genes required for cellulose synthesis in the secondary wall.2003 · DOI: 10.1104/pp.103.022442
`Os07g0424400`	Probable catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	No verified direct reference in this release
`Os03g0837100`	Probable catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	No verified direct reference in this release
`UniProt: A2XNT2`	Probable catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036828 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0009833 plant-type primary cell wall biogenesis Biological Process

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0030244 cellulose biosynthetic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0016759 cellulose synthase activity Molecular Function

GO:0016760 cellulose synthase (UDP-forming) activity Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT5G44030

dosa:Os03g0837100

dosa:Os07g0424400

dosa:Os10g0467800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.610

Rank 1 · LXL04_036828 · OH-1004

Endoplasmic reticulum0.181

Rank 2 · LXL04_036828 · OH-1004

Golgi apparatus0.136

Rank 3 · LXL04_036828 · OH-1004

Cytoplasm0.131

Rank 4 · LXL04_036828 · OH-1004

Lysosome / Vacuole0.089

Rank 5 · LXL04_036828 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14569.13zf-UDP17-85 aa

PF03552.21Cellulose_synt284-1019 aa

PF13632.13Glyco_trans_2_3717-823 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036828	`PF14569.13`	zf-UDP	17	85	1.2e-27	96.4
LXL04_036828	`PF03552.21`	Cellulose_synt	284	1019		1353.5
LXL04_036828	`PF13632.13`	Glyco_trans_2_3	717	823	8.8e-06	26.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JA6`	Arabidopsis thaliana	Cellulose synthase A catalytic subunit 4 [UDP-forming]	78.932%	Swiss-Prot	strong database homology
`Q9AV71`	Oryza sativa subsp. japonica	Cellulose synthase A catalytic subunit 7 [UDP-forming]	75.545%	Swiss-Prot	strong database homology
`Q69V23`	Oryza sativa subsp. japonica	Probable cellulose synthase A catalytic subunit 3 [UDP-forming]	64.455%	Swiss-Prot	strong database homology
`Q851L8`	Oryza sativa subsp. japonica	Probable cellulose synthase A catalytic subunit 5 [UDP-forming]	64.331%	Swiss-Prot	strong database homology
`A2XNT2`	Oryza sativa subsp. indica	Probable cellulose synthase A catalytic subunit 5 [UDP-forming]	64.331%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card