LXL04_036541 | RubberDandelionOmics

Gene overview

LXL04_036541

Reference: OH-1004 Chr: Chr08 Coordinates: 44187835-44191466 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2475 bp · LXL04_036541|LXL04_036541|OH1004|cDNA

ATGCTAGCTCCTAAACTACCAGAGAAACAGTCCCAACGCCACAACCTTTTCCGGACACGTTGCGTGGTACATCAGAAGGTTTTTGATGTGATTATTGACAGTGGAAGCACTGAAAACATTGTGTCTCGGGAGATTGTACATCGTCTCAACTTACCAACCGAGAAGCATCCTAGCCCTTACAAAATAGGTTGGATCAAATCGGTGGGCAAGATTCGAGTCACTGAACAATGCAAAATCCCGTTCTCCATTGGTAAGTACAA...

CDS

Download CDS FASTA

2475 bp · LXL04_036541|LXL04_036541|OH1004|CDS

ATGCTAGCTCCTAAACTACCAGAGAAACAGTCCCAACGCCACAACCTTTTCCGGACACGTTGCGTGGTACATCAGAAGGTTTTTGATGTGATTATTGACAGTGGAAGCACTGAAAACATTGTGTCTCGGGAGATTGTACATCGTCTCAACTTACCAACCGAGAAGCATCCTAGCCCTTACAAAATAGGTTGGATCAAATCGGTGGGCAAGATTCGAGTCACTGAACAATGCAAAATCCCGTTCTCCATTGGTAAGTACAA...

Protein

Download Protein FASTA

824 aa · LXL04_036541|LXL04_036541|OH1004|PROTEIN

MLAPKLPEKQSQRHNLFRTRCVVHQKVFDVIIDSGSTENIVSREIVHRLNLPTEKHPSPYKIGWIKSVGKIRVTEQCKIPFSIGKYKDEVLFDIVDMDACHILLGRPWEFDVNAVHKGKENTYSFKINGVKMILVPLMETIKTKAVQHEPTRNNLVVLAQRDFEEEIKGESVIYAIVATGSIQEGIDNKIPDKLMPIMKQFQSIIPNELPATLPPMRDIQHQIDFIPGSKLPNLAHYRMSPKENLILQEQVEDLLKKGLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036541`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036541

Location Chr08:44187835-44191466 (+)

Description Similar to CYP704C1: Cytochrome P450 704C1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69500`	Involved in pollen wall development.	CYP704B1 is a long-chain fatty acid omega-hydroxylase essential for sporopollenin synthesis in pollen of Arabidopsis.2009 · DOI: 10.1104/pp.109.144469
`At2g45970`	Catalyzes the omega-hydroxylation of various fatty acids (FA).	Functional analysis of the LACERATA gene of Arabidopsis provides evidence for different roles of fatty acid omega -hydroxylation in development.2001 · DOI: 10.1073/pnas.171285998 Molecular definitions of fatty acid hydroxylases in Arabidopsis thaliana.2007 · DOI: 10.1002/prot.21335
`At5g23190`	Involved in very long chain fatty acids (VLCFA) omega- hydroxylation.	CYP86B1 is required for very long chain omega-hydroxyacid and alpha, omega -dicarboxylic acid synthesis in root and seed suberin polyester.2009 · DOI: 10.1104/pp.109.141408 Identification of an Arabidopsis feruloyl-coenzyme A transferase required for suberin synthesis.2009 · DOI: 10.1104/pp.109.144907

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036541 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0008610 lipid biosynthetic process Biological Process

GO:0010214 seed coat development Biological Process

GO:0010345 suberin biosynthetic process Biological Process

GO:0010584 pollen exine formation Biological Process

GO:0035336 long-chain fatty-acyl-CoA metabolic process Biological Process

GO:0042761 very long-chain fatty acid biosynthetic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0080110 sporopollenin biosynthetic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ag:AAZ39642

ath:AT1G69500

ath:AT2G45970

ath:AT5G23190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.867

Rank 1 · LXL04_036541 · OH-1004

Cytoplasm0.091

Rank 2 · LXL04_036541 · OH-1004

Cell membrane0.050

Rank 3 · LXL04_036541 · OH-1004

Nucleus0.040

Rank 4 · LXL04_036541 · OH-1004

Mitochondrion0.039

Rank 5 · LXL04_036541 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30863.1PRO_PEG10-RTL130-108 aa

PF00067.28p450352-810 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036541	`PF30863.1`	PRO_PEG10-RTL1	30	108	2.9e-10	41.3
LXL04_036541	`PF00067.28`	p450	352	810	8.4e-71	239.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C788`	Arabidopsis thaliana	Cytochrome P450 704B1	41.491%	Swiss-Prot	moderate database homology
`O80823`	Arabidopsis thaliana	Cytochrome P450 86A8	37.917%	Swiss-Prot	moderate database homology
`Q9FMY1`	Arabidopsis thaliana	Cytochrome P450 86B1	36.016%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card