LXL04_036512 | RubberDandelionOmics

Gene overview

LXL04_036512

Reference: OH-1004 Chr: Chr08 Coordinates: 43691586-43694444 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1695 bp · LXL04_036512|LXL04_036512|OH1004|cDNA

ATGGACGCCTTAGCTTTCTCTGCCGTTACTTCCCGCCATATCTCCGTAACTCTCCCGAGAAAGACGCACCACAATCACCCTTCTTCACCTTGGACCGGTTCAACTTCGCCGCACATGCTCTCATTCCGCTTCAGCAATTCATCATCGACGAGAGAGCTATGGGGAATTGTGAATTCTCAGAGAGTAATTACGGTCAGGAGGGAGAGGCGTGGAGTAATCCGAGCAGAAATGTTCGGTCAGCTAACTAGCGGCCTCGAATC...

CDS

Download CDS FASTA

1695 bp · LXL04_036512|LXL04_036512|OH1004|CDS

ATGGACGCCTTAGCTTTCTCTGCCGTTACTTCCCGCCATATCTCCGTAACTCTCCCGAGAAAGACGCACCACAATCACCCTTCTTCACCTTGGACCGGTTCAACTTCGCCGCACATGCTCTCATTCCGCTTCAGCAATTCATCATCGACGAGAGAGCTATGGGGAATTGTGAATTCTCAGAGAGTAATTACGGTCAGGAGGGAGAGGCGTGGAGTAATCCGAGCAGAAATGTTCGGTCAGCTAACTAGCGGCCTCGAATC...

Protein

Download Protein FASTA

564 aa · LXL04_036512|LXL04_036512|OH1004|PROTEIN

MDALAFSAVTSRHISVTLPRKTHHNHPSSPWTGSTSPHMLSFRFSNSSSTRELWGIVNSQRVITVRRERRGVIRAEMFGQLTSGLESAWNRLKGEEVLTKENIVEPMRDIRRALLEADVSLPVVRRFVQTVSEQAVGVGVIRGVRPDQQLVKIVSDELVKLMGGEVSELTFSKSGPTVILLAGLQGVGKTTVSAKLALYLKKQGKSCMLIAGDVYRPAAIDQLVILGKQVDVPVYAVGTDVKPAEIAKQGLQEAKKKNVD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036512`
TK1151 ID	TkA04G039800
OH-1004 ID	LXL04_036512
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 92.014 / OH-1004 93.972 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036512

Location Chr08:43691586-43694444 (-)

Description Similar to FFC: Signal recognition particle 54 kDa protein, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03940`	Involved in cotranslational and post-translational sorting of thylakoid proteins.	Functional characterization of recombinant chloroplast signal recognition particle.2001 · DOI: 10.1074/jbc.m103470200 Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis.2008 · DOI: 10.1104/pp.108.124545

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036512 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006614 SRP-dependent cotranslational protein targeting to membrane Biological Process

GO:0070208 protein heterotrimerization Biological Process

GO:0005786 signal recognition particle, endoplasmic reticulum targeting Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0048500 signal recognition particle Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0008312 7S RNA binding Molecular Function

GO:0019904 protein domain specific binding Molecular Function

KEGG gene cross-reference

ath:AT5G03940

bsu:BSU15980

smu:SMU_1060

syf:Synpcc7942_1771

syn:slr1531

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.966

Rank 1 · LXL04_036512 · OH-1004

Mitochondrion0.047

Rank 2 · LXL04_036512 · OH-1004

Cytoplasm0.014

Rank 3 · LXL04_036512 · OH-1004

Nucleus0.014

Rank 4 · LXL04_036512 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_036512 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02881.25SRP54_N81-158 aa

PF06414.19Zeta_toxin171-274 aa

PF00448.29SRP54176-371 aa

PF01656.30CbiA186-329 aa

PF02978.27SRP_SPB385-508 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036512	`PF02881.25`	SRP54_N	81	158	7.2e-18	65.3
LXL04_036512	`PF06414.19`	Zeta_toxin	171	274	8.6e-08	32.6
LXL04_036512	`PF00448.29`	SRP54	176	371	1.8e-76	256.9
LXL04_036512	`PF01656.30`	CbiA	186	329	1.3e-06	29.1
LXL04_036512	`PF02978.27`	SRP_SPB	385	508	6.7e-35	120.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P37107`	Arabidopsis thaliana	Signal recognition particle subunit SRP54, chloroplastic	81.481%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card