LXL04_036478 | RubberDandelionOmics

Gene overview

LXL04_036478

Reference: OH-1004 Chr: Chr08 Coordinates: 43021508-43025897 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2415 bp · LXL04_036478|LXL04_036478|OH1004|cDNA

ATGGATGAAGAATTACTCGAACTACAGCGGCAATTTGAATCCGCTCAACAAGCGAAATCAAGCATTCGTTTATCAGAACGAAACGTCGTTGAATTAGTTCAAAAGCTTCAACAACTCCATATCATCGACTTCGATCTCCTACACACTGTATCCGGCAAAGAGTACATCACTCCTGAGCATCTACGGCTTGAGATTGTGTCAGAGATAAAGAAAATAGGGCGTGTCTCGTTGATTGATCTTGCTGATATTGTTGGTGTTGA...

CDS

Download CDS FASTA

2415 bp · LXL04_036478|LXL04_036478|OH1004|CDS

ATGGATGAAGAATTACTCGAACTACAGCGGCAATTTGAATCCGCTCAACAAGCGAAATCAAGCATTCGTTTATCAGAACGAAACGTCGTTGAATTAGTTCAAAAGCTTCAACAACTCCATATCATCGACTTCGATCTCCTACACACTGTATCCGGCAAAGAGTACATCACTCCTGAGCATCTACGGCTTGAGATTGTGTCAGAGATAAAGAAAATAGGGCGTGTCTCGTTGATTGATCTTGCTGATATTGTTGGTGTTGA...

Protein

Download Protein FASTA

804 aa · LXL04_036478|LXL04_036478|OH1004|PROTEIN

MDEELLELQRQFESAQQAKSSIRLSERNVVELVQKLQQLHIIDFDLLHTVSGKEYITPEHLRLEIVSEIKKIGRVSLIDLADIVGVDLYHVEKQAQVVVANDSSLMLINGEIISDWYWNNVCEEINDRLQECSQIALAEIAAQLQVGSELLVTVLEPRLGSLIKGRLEGGQIYTPAYVARVNAMVRGAARGITVPMNLSMLWSSLQILLQEMDGASGVAVEGSFFQSMFNGLVKEGQVLGSVRAGVHWTPSVFAIAQREC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036478`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036478

Location Chr08:43021508-43025897 (+)

Description Similar to Os05g0117600: E3 UFM1-protein ligase 1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46220`	E3 UFM1-protein ligase that mediates ufmylation of target proteins.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0117600`	E3 UFM1-protein ligase that mediates ufmylation of target proteins.	No verified direct reference in this release
`UniProt: B8AXB6`	E3 UFM1-protein ligase that mediates ufmylation of target proteins.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036478 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000077 DNA damage checkpoint signaling Biological Process

GO:0006281 DNA repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010508 positive regulation of autophagy Biological Process

GO:0031397 negative regulation of protein ubiquitination Biological Process

GO:0032434 regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0032790 ribosome disassembly Biological Process

GO:0032880 regulation of protein localization Biological Process

GO:0033146 regulation of intracellular estrogen receptor signaling pathway Biological Process

GO:0034976 response to endoplasmic reticulum stress Biological Process

KEGG gene cross-reference

ath:AT3G46220

dosa:Os05g0117600

osa:9266232

rno:313115

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.452

Rank 1 · LXL04_036478 · OH-1004

Nucleus0.435

Rank 2 · LXL04_036478 · OH-1004

Golgi apparatus0.135

Rank 3 · LXL04_036478 · OH-1004

Endoplasmic reticulum0.076

Rank 4 · LXL04_036478 · OH-1004

Lysosome / Vacuole0.051

Rank 5 · LXL04_036478 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09743.15E3_UFM1_ligase4-288 aa

PF25870.2WHD_UFL1_5th305-351 aa

PF23659.2UFL1549-678 aa

PF25041.2UFL1_C683-796 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036478	`PF09743.15`	E3_UFM1_ligase	4	288	3.3e-98	329.4
LXL04_036478	`PF25870.2`	WHD_UFL1_5th	305	351	8.1e-10	39.2
LXL04_036478	`PF23659.2`	UFL1	549	678	3.3e-32	112.1
LXL04_036478	`PF25041.2`	UFL1_C	683	796	4.2e-30	104.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX73`	Arabidopsis thaliana	E3 UFM1-protein ligase 1 homolog	59.181%	Swiss-Prot	strong database homology
`B9FM64`	Oryza sativa subsp. japonica	E3 UFM1-protein ligase 1 homolog	57.248%	Swiss-Prot	strong database homology
`B8AXB6`	Oryza sativa subsp. indica	E3 UFM1-protein ligase 1 homolog	57.248%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card