LXL04_036435 | RubberDandelionOmics

Gene overview

LXL04_036435

Reference: OH-1004 Chr: Chr08 Coordinates: 41880958-41882694 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1644 bp · LXL04_036435|LXL04_036435|OH1004|cDNA

ATGCAAGCGGCAGTCCCCCTGTTTGAACGCCAGTTCTTTctagcatttcgtcgagcactttCCAACTCTTGTTCCTCCCAACGCCTCCTCATTCCCAATGCTCTTACATTCTCTACTCATGCGACAGATAATTTAGAACCTATCAAGGACGAAGATGAGAAAGCAGAAATCAAATACAGCTTACGAACAACTGACGGCGCGGAATCAATCAGCGAGGATAATGAAGAAGCTCCCGGAAGCTTATGTGGGAGGATAGAGAA...

CDS

Download CDS FASTA

1644 bp · LXL04_036435|LXL04_036435|OH1004|CDS

ATGCAAGCGGCAGTCCCCCTGTTTGAACGCCAGTTCTTTCTAGCATTTCGTCGAGCACTTTCCAACTCTTGTTCCTCCCAACGCCTCCTCATTCCCAATGCTCTTACATTCTCTACTCATGCGACAGATAATTTAGAACCTATCAAGGACGAAGATGAGAAAGCAGAAATCAAATACAGCTTACGAACAACTGACGGCGCGGAATCAATCAGCGAGGATAATGAAGAAGCTCCCGGAAGCTTATGTGGGAGGATAGAGAA...

Protein

Download Protein FASTA

547 aa · LXL04_036435|LXL04_036435|OH1004|PROTEIN

MQAAVPLFERQFFLAFRRALSNSCSSQRLLIPNALTFSTHATDNLEPIKDEDEKAEIKYSLRTTDGAESISEDNEEAPGSLCGRIEKLARGDPVGSAFQSWMGDGFPIHRGDIFHTINRLRKRKFNKRALEVMEWVIRERPYMPKQLDYSFLLEFTAKLHGIPQGEKLFSHIPSEFQDELLYNNLVIACLDKGMIRLSLAYMKKMRELGHSISYMVFNRLIILHSSPSRRKSIPKILTQMKADKVPRHVSTYNILLKMEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036435`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036435

Location Chr08:41880958-41882694 (-)

Description Similar to At1g07590: Pentatricopeptide repeat-containing protein At1g07590, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07590`	Pentatricopeptide repeat-containing protein At1g07590, mitochondrial.	No verified direct reference in this release
`At1g15480`	Pentatricopeptide repeat-containing protein At1g15480, mitochondrial.	No verified direct reference in this release
`At1g80270`	Pentatricopeptide repeat-containing protein At1g80270, mitochondrial.	No verified direct reference in this release
`At1g60770`	Large ribosomal subunit protein mL101 (rPPR4).	No verified direct reference in this release
`At1g02150`	Pentatricopeptide repeat-containing protein At1g02150.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036435 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0080156 mitochondrial mRNA modification Biological Process

GO:1902775 mitochondrial large ribosomal subunit assembly Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005840 ribosome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0140978 mitochondrial large ribosomal subunit binding Molecular Function

KEGG gene cross-reference

ath:AT1G02150

ath:AT1G07590

ath:AT1G15480

ath:AT1G60770

ath:AT1G80270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.779

Rank 1 · LXL04_036435 · OH-1004

Plastid0.142

Rank 2 · LXL04_036435 · OH-1004

Nucleus0.056

Rank 3 · LXL04_036435 · OH-1004

Cytoplasm0.030

Rank 4 · LXL04_036435 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_036435 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070.1MSC6_N231-411 aa

PF13812.13PPR_3235-290 aa

PF13041.13PPR_2249-293 aa

PF13041.13PPR_2388-433 aa

PF01535.27PPR390-418 aa

PF12854.14PPR_1391-415 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036435	`PF29070.1`	MSC6_N	231	411	6.5e-11	42.7
LXL04_036435	`PF13812.13`	PPR_3	235	290	2.9e-17	63.2
LXL04_036435	`PF13041.13`	PPR_2	249	293	1.9e-34	118.3
LXL04_036435	`PF13041.13`	PPR_2	388	433	1.9e-34	118.3
LXL04_036435	`PF01535.27`	PPR	390	418	2.4e-24	84.6
LXL04_036435	`PF12854.14`	PPR_1	391	415	2.8e-14	53.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940Q2`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g07590, mitochondrial	64.363%	Swiss-Prot	strong database homology
`Q9XI21`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g15480, mitochondrial	26.346%	Swiss-Prot	weak database homology
`Q9C977`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g80270, mitochondrial	25.761%	Swiss-Prot	weak database homology
`O22714`	Arabidopsis thaliana	Large ribosomal subunit protein mL101 (rPPR4)	25.282%	Swiss-Prot	weak database homology
`Q8LPS6`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g02150	25.310%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card