LXL04_036416 | RubberDandelionOmics

Gene overview

LXL04_036416

Reference: OH-1004 Chr: Chr08 Coordinates: 41606772-41609774 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2913 bp · LXL04_036416|LXL04_036416|OH1004|cDNA

ATGTCATTCCCAACCCACGCTGCTTCAGAACCTAAGAAAGCTTCATCAATCATCACCCATATAACCATATTCAATAATTTTAAAGCTTTGGAATCGACTCTTTATCGACAACGAGAAGAGTCCGCATCAATGCTAGCCAGGAAGCAGAGGATTTGCAAGCTATCGGCGACGGCAGATGACGATGATGAGATAGCAGAGAATGATCGCTCTGTTTATGTTCCCTCTCAATCGAAACAAGCTGTAAAACGATTTAGGAAGAA...

CDS

Download CDS FASTA

2913 bp · LXL04_036416|LXL04_036416|OH1004|CDS

ATGTCATTCCCAACCCACGCTGCTTCAGAACCTAAGAAAGCTTCATCAATCATCACCCATATAACCATATTCAATAATTTTAAAGCTTTGGAATCGACTCTTTATCGACAACGAGAAGAGTCCGCATCAATGCTAGCCAGGAAGCAGAGGATTTGCAAGCTATCGGCGACGGCAGATGACGATGATGAGATAGCAGAGAATGATCGCTCTGTTTATGTTCCCTCTCAATCGAAACAAGCTGTAAAACGATTTAGGAAGAA...

Protein

Download Protein FASTA

970 aa · LXL04_036416|LXL04_036416|OH1004|PROTEIN

MSFPTHAASEPKKASSIITHITIFNNFKALESTLYRQREESASMLARKQRICKLSATADDDDEIAENDRSVYVPSQSKQAVKRFRKKGDNKEDEDDEGTVILKQERMVKQKTSPDESDDSESEEERNRDQVERKELERNLKEKDAARTTKLSERKLSKREENEAVRRADDDIGALRKISRQEYLKKREKKKLEEIRGDIEDEEYLFHGVKSTEAKQRELRYKKDVYDLVKKRSQEDDNVNQYYRLPDAYDEEGQVNQDKR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036416`
TK1151 ID	TkA04G048480
OH-1004 ID	LXL04_036416
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	94.300
Protein coverage (%)	TK1151 100.000 / OH-1004 51.134 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036416

Location Chr08:41606772-41609774 (+)

Description Similar to ESP3: Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32490`	Involved in pre-mRNA splicing.	No verified direct reference in this release
`At2g35340`	May be involved in pre-mRNA splicing.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036416 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0035194 regulatory ncRNA-mediated post-transcriptional gene silencing Biological Process

GO:0045087 innate immune response Biological Process

GO:0140374 antiviral innate immune response Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G32490

ath:AT2G35340

hsa:8449

ptr:462546

ssc:100144456

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.800

Rank 1 · LXL04_036416 · OH-1004

Cytoplasm0.245

Rank 2 · LXL04_036416 · OH-1004

Mitochondrion0.031

Rank 3 · LXL04_036416 · OH-1004

Cell membrane0.024

Rank 4 · LXL04_036416 · OH-1004

Endoplasmic reticulum0.019

Rank 5 · LXL04_036416 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD364-516 aa

PF13401.13AAA_22372-505 aa

PF00271.38Helicase_C567-689 aa

PF04408.30WHD_HA2751-779 aa

PF21010.3HA2_C780-841 aa

PF07717.23OB_NTP_bind875-946 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036416	`PF00270.36`	DEAD	364	516	1.1e-07	32.4
LXL04_036416	`PF13401.13`	AAA_22	372	505	4.9e-06	27.6
LXL04_036416	`PF00271.38`	Helicase_C	567	689	2.1e-11	44.7
LXL04_036416	`PF04408.30`	WHD_HA2	751	779	1.9e-09	38.1
LXL04_036416	`PF21010.3`	HA2_C	780	841	1.8e-10	41.9
LXL04_036416	`PF07717.23`	OB_NTP_bind	875	946	2.3e-19	70.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VY00`	Arabidopsis thaliana	Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH1	68.313%	Swiss-Prot	strong database homology
`F4IJV4`	Arabidopsis thaliana	Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH6	65.841%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card