LXL04_036415 | RubberDandelionOmics

Gene overview

LXL04_036415

Reference: OH-1004 Chr: Chr08 Coordinates: 41567770-41571637 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2469 bp · LXL04_036415|LXL04_036415|OH1004|cDNA

ATGATGTTTTCAAGACTTGGTCGGTCGATCTCTCGATCGGCTCGTTCAAGGAATGTTCTGAGTGGTGGGAATGGCGGAAGGTCACAGATTTTGACCGATTCTCAAGCATATCAATCCCAACATATTGGACAAGCAGATGATAGCGTGGGGGTTTTGAAGCGTTATCTAGGTTCTCTAGCAGCTAACAATGAAATGTTTGGTTCTGGGTTATCATCCAAGACGTATCTATCGGATATCAAATATGTTCTCGCAAACCCTAA...

CDS

Download CDS FASTA

2469 bp · LXL04_036415|LXL04_036415|OH1004|CDS

ATGATGTTTTCAAGACTTGGTCGGTCGATCTCTCGATCGGCTCGTTCAAGGAATGTTCTGAGTGGTGGGAATGGCGGAAGGTCACAGATTTTGACCGATTCTCAAGCATATCAATCCCAACATATTGGACAAGCAGATGATAGCGTGGGGGTTTTGAAGCGTTATCTAGGTTCTCTAGCAGCTAACAATGAAATGTTTGGTTCTGGGTTATCATCCAAGACGTATCTATCGGATATCAAATATGTTCTCGCAAACCCTAA...

Protein

Download Protein FASTA

822 aa · LXL04_036415|LXL04_036415|OH1004|PROTEIN

MMFSRLGRSISRSARSRNVLSGGNGGRSQILTDSQAYQSQHIGQADDSVGVLKRYLGSLAANNEMFGSGLSSKTYLSDIKYVLANPKFQRFFSSEAPKKKNYENFFPKEKKETPKGNNQKSESKEESSTEDDGSFFPKQFNFQIPIPLLVIGLLLFSSLSSFGPREQKQISFQEFKNKLLEPGLVDHIVISNKSVAKVYVRNTPRNQSTDSTMEGTSIDSPARVNTSQYKYYFNIGSVESFEEKLEEAQEALGIDSHDYV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036415`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036415

Location Chr08:41567770-41571637 (-)

Description Similar to FTSH10: ATP-dependent zinc metalloprotease FTSH 10, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07510`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release
`At2g29080`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0458400`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release
`Os01g0842600`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036415 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006465 signal peptide processing Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0034982 mitochondrial protein processing Biological Process

GO:0051604 protein maturation Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005745 m-AAA complex Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0097002 mitochondrial inner boundary membrane Cellular Component

GO:0004176 ATP-dependent peptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G07510

ath:AT2G29080

dosa:Os01g0842600

dosa:Os05g0458400

sce:YMR089C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.929

Rank 1 · LXL04_036415 · OH-1004

Cytoplasm0.064

Rank 2 · LXL04_036415 · OH-1004

Nucleus0.055

Rank 3 · LXL04_036415 · OH-1004

Plastid0.036

Rank 4 · LXL04_036415 · OH-1004

Cell membrane0.025

Rank 5 · LXL04_036415 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06480.21FtsH_ext144-257 aa

PF00004.36AAA370-502 aa

PF17862.8AAA_lid_3532-570 aa

PF01434.25Peptidase_M41585-767 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036415	`PF06480.21`	FtsH_ext	144	257	2.7e-13	50.7
LXL04_036415	`PF00004.36`	AAA	370	502	6e-43	147.1
LXL04_036415	`PF17862.8`	AAA_lid_3	532	570	2.6e-11	43.6
LXL04_036415	`PF01434.25`	Peptidase_M41	585	767	1.6e-66	224.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZI8`	Arabidopsis thaliana	ATP-dependent zinc metalloprotease FTSH 10, mitochondrial	72.014%	Swiss-Prot	strong database homology
`Q84WU8`	Arabidopsis thaliana	ATP-dependent zinc metalloprotease FTSH 3, mitochondrial	73.583%	Swiss-Prot	strong database homology
`Q0DHL4`	Oryza sativa subsp. japonica	ATP-dependent zinc metalloprotease FTSH 8, mitochondrial	76.923%	Swiss-Prot	strong database homology
`Q8S2A7`	Oryza sativa subsp. japonica	ATP-dependent zinc metalloprotease FTSH 3, mitochondrial	68.961%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card