LXL04_036047 | RubberDandelionOmics

Gene overview

LXL04_036047

Reference: OH-1004 Chr: Chr08 Coordinates: 34695396-34697906 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2511 bp · LXL04_036047|LXL04_036047|OH1004|cDNA

ATGGAAGAAGACCAAGAAAGAGAAAGATTTGGCATGGAGAACGACTATGAAGGTGGGCAGTGGATAGGAGGCGAATTCTATTATGGAAAACGAAAGGAAAAACACCACCAGACCAAAGATGATCAGCTATACGGTATCTTTGCTTCTGGTGACTCGGATAGTGACTCAGAAGGCAGCTCCAAGAAAAGACGAAAAAAAGGTTTATCCAAAAAACAACAAGATCTCACCAAACCCCTCAATTTTGTCTCAAGTGGGATTGT...

CDS

Download CDS FASTA

2511 bp · LXL04_036047|LXL04_036047|OH1004|CDS

ATGGAAGAAGACCAAGAAAGAGAAAGATTTGGCATGGAGAACGACTATGAAGGTGGGCAGTGGATAGGAGGCGAATTCTATTATGGAAAACGAAAGGAAAAACACCACCAGACCAAAGATGATCAGCTATACGGTATCTTTGCTTCTGGTGACTCGGATAGTGACTCAGAAGGCAGCTCCAAGAAAAGACGAAAAAAAGGTTTATCCAAAAAACAACAAGATCTCACCAAACCCCTCAATTTTGTCTCAAGTGGGATTGT...

Protein

Download Protein FASTA

836 aa · LXL04_036047|LXL04_036047|OH1004|PROTEIN

MEEDQERERFGMENDYEGGQWIGGEFYYGKRKEKHHQTKDDQLYGIFASGDSDSDSEGSSKKRRKKGLSKKQQDLTKPLNFVSSGIVMPNEEIDDITKQEKQKDDQDDDNHPGLGQGLGFNSDKKEVNETPIDFLPTAFGKMIKEGALQRREKEIEKSRLTKKSTNLGLGKREAKDDGNVGVFEKHTKGIGMKLLEKMGYKGGGLGRNAQGIVAPIEAKLRPKNMGMGFNDYKEAANAPTLLESTDEIKVLTQTTTQQKD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036047`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036047

Location Chr08:34695396-34697906 (+)

Description Similar to STIPL1: Septin and tuftelin-interacting protein 1 homolog 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17070`	Involved in pre-mRNA splicing, specifically in spliceosome disassembly during late-stage splicing events (By similarity).	Mutation of Arabidopsis spliceosomal timekeeper locus1 causes circadian clock defects.2012 · DOI: 10.1105/tpc.112.104828
`At2g42330`	Involved in pre-mRNA splicing, specifically in spliceosome disassembly during late-stage splicing events.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036047 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000390 spliceosomal complex disassembly Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0042752 regulation of circadian rhythm Biological Process

GO:0005634 nucleus Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0031981 nuclear lumen Cellular Component

GO:0071008 U2-type post-mRNA release spliceosomal complex Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:1990446 U1 snRNP binding Molecular Function

KEGG gene cross-reference

ath:AT1G17070

ath:AT2G42330

bta:509349

xla:447466

xtr:100038256

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.533

Rank 1 · LXL04_036047 · OH-1004

Cytoplasm0.414

Rank 2 · LXL04_036047 · OH-1004

Golgi apparatus0.072

Rank 3 · LXL04_036047 · OH-1004

Endoplasmic reticulum0.067

Rank 4 · LXL04_036047 · OH-1004

Cell membrane0.043

Rank 5 · LXL04_036047 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12457.14TIP_N4-109 aa

PF01585.29G-patch187-228 aa

PF07842.18GCFC405-666 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036047	`PF12457.14`	TIP_N	4	109	2e-22	80.2
LXL04_036047	`PF01585.29`	G-patch	187	228	2.5e-14	53.6
LXL04_036047	`PF07842.18`	GCFC	405	666	8.9e-81	272.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHG6`	Arabidopsis thaliana	Septin and tuftelin-interacting protein 1 homolog 1	52.656%	Swiss-Prot	strong database homology
`Q9SLC6`	Arabidopsis thaliana	Septin and tuftelin-interacting protein 1 homolog 2	46.848%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card