LXL04_035999 | RubberDandelionOmics

Gene overview

LXL04_035999

Reference: OH-1004 Chr: Chr08 Coordinates: 33750340-33750822 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

483 bp · LXL04_035999|LXL04_035999|OH1004|cDNA

ATGGAAGAAATCAATGGAAGTGATCAAGGAATCCAAAACAAGGCCACAGTTAACGCTCTTTACAAGGCCTTGGCTGTCGGAGATACAAAACTACTCTCCAGCATCTTAGCCGCCGACCTTGAGTGGTGGTTCCACGGTCCTCAAAACTGCCACcacatgatgaagatgctcacCGGAGAAGCTCCACACACTGAGTTCAACTTTGAACCTCGAAGCGTTACAACCATCGATGATCATACAGTGATCGTCGAGGGTTATGA...

CDS

Download CDS FASTA

483 bp · LXL04_035999|LXL04_035999|OH1004|CDS

ATGGAAGAAATCAATGGAAGTGATCAAGGAATCCAAAACAAGGCCACAGTTAACGCTCTTTACAAGGCCTTGGCTGTCGGAGATACAAAACTACTCTCCAGCATCTTAGCCGCCGACCTTGAGTGGTGGTTCCACGGTCCTCAAAACTGCCACCACATGATGAAGATGCTCACCGGAGAAGCTCCACACACTGAGTTCAACTTTGAACCTCGAAGCGTTACAACCATCGATGATCATACAGTGATCGTCGAGGGTTATGA...

Protein

Download Protein FASTA

160 aa · LXL04_035999|LXL04_035999|OH1004|PROTEIN

MEEINGSDQGIQNKATVNALYKALAVGDTKLLSSILAADLEWWFHGPQNCHHMMKMLTGEAPHTEFNFEPRSVTTIDDHTVIVEGYEGANVYWVHVWALKDGLITWFREYFNTWLTVKELKVRPVGRPLGWTGKENRSTVWRSQPRDLFRRSLPGLMLAI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035999`
TK1151 ID	TkA04G086030
OH-1004 ID	LXL04_035999
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035999

Location Chr08:33750340-33750822 (-)

Description Similar to SAG20: Senescence associated gene 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10985`	Senescence associated gene 20.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035999 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002238 response to molecule of fungal origin Biological Process

GO:0009620 response to fungus Biological Process

GO:0009624 response to nematode Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010193 response to ozone Biological Process

KEGG gene cross-reference

ath:AT3G10985

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.549

Rank 1 · LXL04_035999 · OH-1004

Nucleus0.283

Rank 2 · LXL04_035999 · OH-1004

Mitochondrion0.129

Rank 3 · LXL04_035999 · OH-1004

Peroxisome0.096

Rank 4 · LXL04_035999 · OH-1004

Cell membrane0.075

Rank 5 · LXL04_035999 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07107.18WI1254-160 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035999	`PF07107.18`	WI12	54	160	8.4e-31	107.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AK6`	Arabidopsis thaliana	Senescence associated gene 20	37.838%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card