LXL04_035847 | RubberDandelionOmics

Gene overview

LXL04_035847

Reference: OH-1004 Chr: Chr08 Coordinates: 30530680-30532176 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1497 bp · LXL04_035847|LXL04_035847|OH1004|cDNA

ATGACAGCCGCCATACTAACTTCGATGGTGGAGATGGCGATTCTCATATATTTACTCCAACTCGCCACTGCCACCGCCGCcgcatcatcatcatcatcatcatcgttgTTATCCTACCCATCTCACCAATTTCTTGCCGTCCAAGATATCATACGCGCCACAAAATCAGCTTCCCACGTACCCCAAACACAACTACTTGACCAATTAGAATCCGACGAGTCTCACGGCGGCAGAAGATGGAAGCTAAACCTCGTTCATCG...

CDS

Download CDS FASTA

1497 bp · LXL04_035847|LXL04_035847|OH1004|CDS

ATGACAGCCGCCATACTAACTTCGATGGTGGAGATGGCGATTCTCATATATTTACTCCAACTCGCCACTGCCACCGCCGCCGCATCATCATCATCATCATCATCGTTGTTATCCTACCCATCTCACCAATTTCTTGCCGTCCAAGATATCATACGCGCCACAAAATCAGCTTCCCACGTACCCCAAACACAACTACTTGACCAATTAGAATCCGACGAGTCTCACGGCGGCAGAAGATGGAAGCTAAACCTCGTTCATCG...

Protein

Download Protein FASTA

498 aa · LXL04_035847|LXL04_035847|OH1004|PROTEIN

MTAAILTSMVEMAILIYLLQLATATAAASSSSSSSLLSYPSHQFLAVQDIIRATKSASHVPQTQLLDQLESDESHGGRRWKLNLVHRDKLSDSDDGHRRRTEARLERDVKRVAILNSQIGGNRTKGGIQGGRFEVEDIGSEVVSGMRQGSGEYFVRIGVGTPPRSQYMVVDSGSDVVWVQCLPCKQCYQQSDPLFDPANSASFVAVSCNSPVCQHAETAVGCHGHGGGRWCRYEVSYGDGSFTKGTLALETLSFGDTFIR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035847`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035847

Location Chr08:30530680-30532176 (-)

Description Similar to ASPG2: Protein ASPARTIC PROTEASE IN GUARD CELL 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20015`	Aspartic protease that may be involved in drought avoidance through abscisic acid signaling.	No verified direct reference in this release
`At3g18490`	Aspartic protease involved in drought avoidance through abscisic acid signaling.	Overexpression of the aspartic protease ASPG1 gene confers drought avoidance in Arabidopsis.2012 · DOI: 10.1093/jxb/err433
`At1g01300`	Aspartyl protease.	No verified direct reference in this release
`At5g10770`	Probably not redundant with AED1 and not involved in restriction of salicylic acid (SA) or systemic acquired resistance (SAR) signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035847 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0098552 side of membrane Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0070001 aspartic-type peptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G01300

ath:AT3G18490

ath:AT3G20015

ath:AT5G10770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.394

Rank 1 · LXL04_035847 · OH-1004

Cell membrane0.246

Rank 2 · LXL04_035847 · OH-1004

Endoplasmic reticulum0.136

Rank 3 · LXL04_035847 · OH-1004

Lysosome / Vacuole0.102

Rank 4 · LXL04_035847 · OH-1004

Cytoplasm0.100

Rank 5 · LXL04_035847 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00026.29Asp152-205 aa

PF14543.12TAXi_N153-320 aa

PF00026.29Asp233-494 aa

PF14541.12TAXi_C344-494 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035847	`PF00026.29`	Asp	152	205	3.4e-20	73.4
LXL04_035847	`PF14543.12`	TAXi_N	153	320	1.2e-47	163.1
LXL04_035847	`PF00026.29`	Asp	233	494	3.4e-20	73.4
LXL04_035847	`PF14541.12`	TAXi_C	344	494	5.4e-32	111.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHE3`	Arabidopsis thaliana	Protein ASPARTIC PROTEASE IN GUARD CELL 2	66.200%	Swiss-Prot	strong database homology
`Q9LS40`	Arabidopsis thaliana	Protein ASPARTIC PROTEASE IN GUARD CELL 1	46.169%	Swiss-Prot	moderate database homology
`Q9LNJ3`	Arabidopsis thaliana	Aspartyl protease family protein 2	50.000%	Swiss-Prot	strong database homology
`Q8S9J6`	Arabidopsis thaliana	Aspartyl protease family protein At5g10770	40.669%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card