LXL04_035709 | RubberDandelionOmics

Gene overview

LXL04_035709

Reference: OH-1004 Chr: Chr08 Coordinates: 27523548-27528930 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4395 bp · LXL04_035709|LXL04_035709|OH1004|cDNA

GCAATCATTACTTCGTCACTGTTTTCAATGGACCAAAATGAAGTAGCGAGATCCTTAATCACCATAATTGGGAGCTTCATCCAAGACCGGTTGCTTGATGAAAGACAGAGGGCTCTACAGAAGGAACAATGTGGTGAGAGATTAGCAGCAGAAGATGAAAGCAGTAACAAAGACACAGCAGTTAGGTATTCCGATCAAGCAGTTTTGGCGAATCTAGATTGGGGTATGGATGCCCTCGAGGAAGCCATTAATACATCCAA...

CDS

Download CDS FASTA

4377 bp · LXL04_035709|LXL04_035709|OH1004|CDS

CTGTTTTCAATGGACCAAAATGAAGTAGCGAGATCCTTAATCACCATAATTGGGAGCTTCATCCAAGACCGGTTGCTTGATGAAAGACAGAGGGCTCTACAGAAGGAACAATGTGGTGAGAGATTAGCAGCAGAAGATGAAAGCAGTAACAAAGACACAGCAGTTAGGTATTCCGATCAAGCAGTTTTGGCGAATCTAGATTGGGGTATGGATGCCCTCGAGGAAGCCATTAATACATCCAACACTGAAACCAAAATGGC...

Protein

Download Protein FASTA

1458 aa · LXL04_035709|LXL04_035709|OH1004|PROTEIN

MFSMDQNEVARSLITIIGSFIQDRLLDERQRALQKEQCGERLAAEDESSNKDTAVRYSDQAVLANLDWGMDALEEAINTSNTETKMARLDHAEKMLQVCAMLNSSDKTAGVPNFYLSAWAHLNLAYLWKLRNNVTNAVLHVLEMFSIDPFFSRIDFAPDIWKTLFLPHMSSIVGWYSEERHRIMMNMIPDSGDLSFTADFDQYFNESLVLSMRPDQAEKLQKLEQHYGQSLDENTRNYANYFKDCMNHDPETSKKGIPMM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035709`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035709

Location Chr08:27523548-27528930 (+)

Description Similar to CERBERUS: Putative E3 ubiquitin-protein ligase LIN-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0570000`	E3 ubiquitin-protein ligase that negatively regulates programmed cell death and disease resistance.	Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity.2004 · DOI: 10.1105/tpc.104.025171 SPIN1, a K homology domain protein negatively regulated and ubiquitinated by the E3 ubiquitin ligase SPL11, is involved in flowering time control in rice.2008 · DOI: 10.1105/tpc.108.058610
`UniProt: A2ZLU6`	Defense related protein that negatively regulates programmed cell death.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035709 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0009877 nodulation Biological Process

GO:0009908 flower development Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0043069 negative regulation of programmed cell death Biological Process

GO:0048586 regulation of long-day photoperiodism, flowering Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

dosa:Os12g0570000

mtr:11418360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.431

Rank 1 · LXL04_035709 · OH-1004

Nucleus0.325

Rank 2 · LXL04_035709 · OH-1004

Cell membrane0.296

Rank 3 · LXL04_035709 · OH-1004

Lysosome / Vacuole0.072

Rank 4 · LXL04_035709 · OH-1004

Golgi apparatus0.070

Rank 5 · LXL04_035709 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23568.2ARM_LIN11-263 aa

PF04564.22U-box499-569 aa

PF23654.2ARM_LIN_2nd638-796 aa

PF23628.3ARM_LIN_C798-1154 aa

PF24807.2WD40_CDC20-Fz1183-1265 aa

PF23409.2Beta-prop_EML1190-1272 aa

PF25172.2Beta-prop_WDR3_2nd1191-1255 aa

PF25173.2Beta-prop_WDR3_1st1192-1273 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035709	`PF23568.2`	ARM_LIN	11	263	1.3e-74	251.0
LXL04_035709	`PF04564.22`	U-box	499	569	5.4e-17	62.4
LXL04_035709	`PF23654.2`	ARM_LIN_2nd	638	796	4.6e-54	183.1
LXL04_035709	`PF23628.3`	ARM_LIN_C	798	1154	1e-110	370.9
LXL04_035709	`PF24807.2`	WD40_CDC20-Fz	1183	1265	4.7e-13	49.8
LXL04_035709	`PF23409.2`	Beta-prop_EML	1190	1272	3e-08	34.2
LXL04_035709	`PF25172.2`	Beta-prop_WDR3_2nd	1191	1255	1.2e-11	45.1
LXL04_035709	`PF25173.2`	Beta-prop_WDR3_1st	1192	1273	5.3e-14	53.0
LXL04_035709	`PF25174.2`	Beta-prop_THOC3	1193	1269	6.4e-16	58.9
LXL04_035709	`PF23381.2`	Beta-prop_IFT122_1st	1193	1456	1.8e-14	54.5
LXL04_035709	`PF24814.2`	WD40_Prp19	1193	1286	1.7e-13	51.0
LXL04_035709	`PF25175.2`	Beta-prop_WDR5	1193	1263	1.8e-12	47.9
LXL04_035709	`PF25168.2`	Beta-prop_WDR36-Utp21_2nd	1199	1295	1.9e-07	31.4
LXL04_035709	`PF00400.39`	WD40	1215	1250	5.5e-16	59.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0IMG9`	Oryza sativa subsp. japonica	E3 ubiquitin-protein ligase SPL11	45.161%	Swiss-Prot	weak database homology
`A2ZLU6`	Oryza sativa subsp. indica	Protein spotted leaf 11	45.161%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card