LXL04_035676 | RubberDandelionOmics

Gene overview

LXL04_035676

Reference: OH-1004 Chr: Chr08 Coordinates: 26866768-26869879 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

981 bp · LXL04_035676|LXL04_035676|OH1004|cDNA

ATGGCAACCGTAACATCTTCCACCATCTCCATCCCCTCATTCACCGGCCTCAAGGTTGCCACCACCACCTCAAGGGCGACCACCGCTACCGTCAAGGTAGCGTCCGCCACCCCCAAGCTCTCAGTGAAAGCTTCACTGAAACAAGCGGTTGCCACAGTTTTAGCTGTGTCCGCTAGCGCGATGCTTGCCAGCAACGCGCTAGCAGTCGAAGTCTTGCTAGGAGACAATGACGGCAGTTTGGTTTTCGAACCATCCACCTT...

CDS

Download CDS FASTA

981 bp · LXL04_035676|LXL04_035676|OH1004|CDS

ATGGCAACCGTAACATCTTCCACCATCTCCATCCCCTCATTCACCGGCCTCAAGGTTGCCACCACCACCTCAAGGGCGACCACCGCTACCGTCAAGGTAGCGTCCGCCACCCCCAAGCTCTCAGTGAAAGCTTCACTGAAACAAGCGGTTGCCACAGTTTTAGCTGTGTCCGCTAGCGCGATGCTTGCCAGCAACGCGCTAGCAGTCGAAGTCTTGCTAGGAGACAATGACGGCAGTTTGGTTTTCGAACCATCCACCTT...

Protein

Download Protein FASTA

326 aa · LXL04_035676|LXL04_035676|OH1004|PROTEIN

MATVTSSTISIPSFTGLKVATTTSRATTATVKVASATPKLSVKASLKQAVATVLAVSASAMLASNALAVEVLLGDNDGSLVFEPSTFSVPAGEKIVFKNNRGFPHNVVFDEDEVPAGVDASKISMSEEDLLNAGGETYTVTLTEKGTYGFYCSPHQGAGMDTTRKIASNDTYCVSSKGSDDTHLYVIEAPNPVNESILPTLVKESLKALLGLGVLSLGGKLILRRVFEVVAEARSSEAFVALCLLTVAGTSLITQKLGFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035676`
TK1151 ID	TkAUNG002030
OH-1004 ID	LXL04_035676
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 95.808 / OH-1004 49.080 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035676

Location Chr08:26866768-26869879 (+)

Description Similar to PETE: Plastocyanin, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76100`	Participates in electron transfer between P700 and the cytochrome b6-f complex in photosystem I.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035676 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009543 chloroplast thylakoid lumen Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0031977 thylakoid lumen Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0009055 electron transfer activity Molecular Function

KEGG gene cross-reference

ath:AT1G76100

sly:544053

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.987

Rank 1 · LXL04_035676 · OH-1004

Mitochondrion0.019

Rank 2 · LXL04_035676 · OH-1004

Cytoplasm0.013

Rank 3 · LXL04_035676 · OH-1004

Peroxisome0.011

Rank 4 · LXL04_035676 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_035676 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13473.13Cupredoxin_151-156 aa

PF00127.27Copper-bind70-163 aa

PF00999.27Na_H_Exchanger195-290 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035676	`PF13473.13`	Cupredoxin_1	51	156	9e-06	26.4
LXL04_035676	`PF00127.27`	Copper-bind	70	163	4.4e-34	117.6
LXL04_035676	`PF00999.27`	Na_H_Exchanger	195	290	7.1e-14	52.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P11490`	Arabidopsis thaliana	Plastocyanin minor isoform, chloroplastic	63.690%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card