LXL04_035608 | RubberDandelionOmics

Gene overview

LXL04_035608

Reference: OH-1004 Chr: Chr08 Coordinates: 25257281-25259567 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

882 bp · LXL04_035608|LXL04_035608|OH1004|cDNA

ATGGCTACTGCCGGCGCCGGTCCCGCCTTTGACTTCTCTGCCGTCAGAGTCCGTGGCAATTCTTCTTTCAGACTTACCGGTTTTGAATTTTCATCATCGACGATTCCTCAACTTTCTCCGTTCAAGTCGTCTTCACCTCACCTCGCTTTCTCTCCGCGTGGATCATCTCATTTTGCTAGAAAGAATATTTTTCAAGCTTCCATCGATGGCGTGGACTCACTTGGTGTAAGCTCTTTGGATGCGGACAATATCCCTACTCC...

CDS

Download CDS FASTA

882 bp · LXL04_035608|LXL04_035608|OH1004|CDS

ATGGCTACTGCCGGCGCCGGTCCCGCCTTTGACTTCTCTGCCGTCAGAGTCCGTGGCAATTCTTCTTTCAGACTTACCGGTTTTGAATTTTCATCATCGACGATTCCTCAACTTTCTCCGTTCAAGTCGTCTTCACCTCACCTCGCTTTCTCTCCGCGTGGATCATCTCATTTTGCTAGAAAGAATATTTTTCAAGCTTCCATCGATGGCGTGGACTCACTTGGTGTAAGCTCTTTGGATGCGGACAATATCCCTACTCC...

Protein

Download Protein FASTA

293 aa · LXL04_035608|LXL04_035608|OH1004|PROTEIN

MATAGAGPAFDFSAVRVRGNSSFRLTGFEFSSSTIPQLSPFKSSSPHLAFSPRGSSHFARKNIFQASIDGVDSLGVSSLDADNIPTPIVLIDQGSDPSATIVHVSFGDRLGALIDTMKSLKDLGLDVAKGTVTTEGSVIETIFFITRLSTGRKVEDPDLLERIRLTIINNLLKYHPESSSRLAMGEAFGIEAPIKKLDVDIETHIHVKDAGPKRSLLCVETEDRPGLLLEIVKIMSDVNVTMESAEIDTEGLIAKDKFHV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035608`
TK1151 ID	TkA04G121280
OH-1004 ID	LXL04_035608
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035608

Location Chr08:25257281-25259567 (-)

Description Similar to ACR12: ACT domain-containing protein ACR12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g04740`	May be involved in feedback regulation of amino acid metabolism.	The ACR11 encodes a novel type of chloroplastic ACT domain repeat protein that is coordinately expressed with GLN2 in Arabidopsis.2011 · DOI: 10.1186/1471-2229-11-118
`At1g16880`	May be involved in feedback regulation of amino acid metabolism.	The ACR11 encodes a novel type of chloroplastic ACT domain repeat protein that is coordinately expressed with GLN2 in Arabidopsis.2011 · DOI: 10.1186/1471-2229-11-118
`At5g65890`	May bind amino acids.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0242700`	ACT domain-containing protein DS12, chloroplastic.	No verified direct reference in this release
`UniProt: P83643`	ACT domain-containing protein DS12, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035608 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009744 response to sucrose Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0010319 stromule Cellular Component

GO:0016597 amino acid binding Molecular Function

KEGG gene cross-reference

ath:AT1G16880

ath:AT5G04740

ath:AT5G65890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.941

Rank 1 · LXL04_035608 · OH-1004

Nucleus0.054

Rank 2 · LXL04_035608 · OH-1004

Mitochondrion0.044

Rank 3 · LXL04_035608 · OH-1004

Cytoplasm0.037

Rank 4 · LXL04_035608 · OH-1004

Peroxisome0.023

Rank 5 · LXL04_035608 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24931.2ACT_ACR9_3rd89-166 aa

PF26956.1ACT_ACR_D195-168 aa

PF26956.1ACT_ACR_D1215-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035608	`PF24931.2`	ACT_ACR9_3rd	89	166	4.5e-10	40.2
LXL04_035608	`PF26956.1`	ACT_ACR_D1	95	168	2.4e-14	53.6
LXL04_035608	`PF26956.1`	ACT_ACR_D1	215	262	2.4e-14	53.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZ23`	Arabidopsis thaliana	ACT domain-containing protein ACR12	69.328%	Swiss-Prot	strong database homology
`Q9FZ47`	Arabidopsis thaliana	ACT domain-containing protein ACR11	61.290%	Swiss-Prot	strong database homology
`Q9FHP1`	Arabidopsis thaliana	ACT domain-containing protein ACR1	25.683%	Swiss-Prot	weak database homology
`Q0J709`	Oryza sativa subsp. japonica	ACT domain-containing protein DS12, chloroplastic	58.525%	Swiss-Prot	strong database homology
`P83643`	Oryza sativa subsp. indica	ACT domain-containing protein DS12, chloroplastic	58.525%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card