LXL04_035530 | RubberDandelionOmics

Gene overview

LXL04_035530

Reference: OH-1004 Chr: Chr08 Coordinates: 24177832-24180040 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1158 bp · LXL04_035530|LXL04_035530|OH1004|cDNA

ATGGCTTCATCGTCTTCTTCAGAAGGTAAAAATGACGAGAGGGAGACGGCTTCTTCGAAGTTGAAAAAGGAAGGATTAGGATGGATGGAGTGGCTTAGAGGTTGGTTCTATTTGGCATACGAGATGCTTTTTCAGAGAATAATGGCGTCTCATTTGCAGAATCCGATGCCTTTGCCTCCCCTCAGCGATTTCACTTGCATCATTACCGGATCAACCAGTGGTATCGGCCGAGAAACTGCCAGACAGCTGGCAGAAGCAGG...

CDS

Download CDS FASTA

1158 bp · LXL04_035530|LXL04_035530|OH1004|CDS

ATGGCTTCATCGTCTTCTTCAGAAGGTAAAAATGACGAGAGGGAGACGGCTTCTTCGAAGTTGAAAAAGGAAGGATTAGGATGGATGGAGTGGCTTAGAGGTTGGTTCTATTTGGCATACGAGATGCTTTTTCAGAGAATAATGGCGTCTCATTTGCAGAATCCGATGCCTTTGCCTCCCCTCAGCGATTTCACTTGCATCATTACCGGATCAACCAGTGGTATCGGCCGAGAAACTGCCAGACAGCTGGCAGAAGCAGG...

Protein

Download Protein FASTA

385 aa · LXL04_035530|LXL04_035530|OH1004|PROTEIN

MASSSSSEGKNDERETASSKLKKEGLGWMEWLRGWFYLAYEMLFQRIMASHLQNPMPLPPLSDFTCIITGSTSGIGRETARQLAEAGAHVVMAVRNTKAAHDQIQKWQDEWSGRGLPLNIEVMELDLLSLDSVVRFSKAWNARLGPLHVLINNAGIFSIGEPQKFSKDGYEEHMQVNHLAPALLSVLLLPSLIRGSPSRIVNVNSIMHQVGFVDTEDMNVVSGKRKFTSLVGYSGSKLAQVMFSNILHKKLPNEAGISVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035530`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035530

Location Chr08:24177832-24180040 (+)

Description Similar to FEY: Dehydrogenase/reductase SDR family member FEY

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27760`	Putative oxidoreductase (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035530 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001523 retinoid metabolic process Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0030178 negative regulation of Wnt signaling pathway Biological Process

GO:0042572 retinol metabolic process Biological Process

GO:0042574 retinal metabolic process Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0071560 cellular response to transforming growth factor beta stimulus Biological Process

GO:0110095 cellular detoxification of aldehyde Biological Process

GO:2000024 regulation of leaf development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G27760

hsa:51109

hsa:51741

mmu:80707

pon:100172779

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.463

Rank 1 · LXL04_035530 · OH-1004

Cytoplasm0.163

Rank 2 · LXL04_035530 · OH-1004

Mitochondrion0.134

Rank 3 · LXL04_035530 · OH-1004

Golgi apparatus0.126

Rank 4 · LXL04_035530 · OH-1004

Nucleus0.099

Rank 5 · LXL04_035530 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08659.17KR65-175 aa

PF00106.32adh_short66-212 aa

PF13561.13adh_short_C272-276 aa

PF00106.32adh_short220-275 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035530	`PF08659.17`	KR	65	175	1.3e-09	38.9
LXL04_035530	`PF00106.32`	adh_short	66	212	4.1e-34	118.5
LXL04_035530	`PF13561.13`	adh_short_C2	72	276	5.6e-20	72.6
LXL04_035530	`PF00106.32`	adh_short	220	275	4.1e-34	118.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JJR8`	Arabidopsis thaliana	Dehydrogenase/reductase SDR family member FEY	74.860%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card