LXL04_035488 | RubberDandelionOmics

Gene overview

LXL04_035488

Reference: OH-1004 Chr: Chr08 Coordinates: 23465195-23469852 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1572 bp · LXL04_035488|LXL04_035488|OH1004|cDNA

ATGGATCATAATGTAATACCAATTATGCAAGCCTTTGATTCAGATGATGGAGAATTTATTTCCACGTATTTTTTAATTCAGTCGGTAGCCACTGAAGAAGAGTCAAACAAAGTGGTACGTACACGAGCTAGAGCTAGTTATAAGTGCACAAATGAACCAGTCTTAACCAGTCTTATTTTGCATAGGGACCGGACCATGTTTGGAAAAGAGTATGTGAGAAAACCAACAAATGGTGATATTGAGAAACTATATGCAGCACA...

CDS

Download CDS FASTA

1572 bp · LXL04_035488|LXL04_035488|OH1004|CDS

ATGGATCATAATGTAATACCAATTATGCAAGCCTTTGATTCAGATGATGGAGAATTTATTTCCACGTATTTTTTAATTCAGTCGGTAGCCACTGAAGAAGAGTCAAACAAAGTGGTACGTACACGAGCTAGAGCTAGTTATAAGTGCACAAATGAACCAGTCTTAACCAGTCTTATTTTGCATAGGGACCGGACCATGTTTGGAAAAGAGTATGTGAGAAAACCAACAAATGGTGATATTGAGAAACTATATGCAGCACA...

Protein

Download Protein FASTA

523 aa · LXL04_035488|LXL04_035488|OH1004|PROTEIN

MDHNVIPIMQAFDSDDGEFISTYFLIQSVATEEESNKVVRTRARASYKCTNEPVLTSLILHRDRTMFGKEYVRKPTNGDIEKLYAAHEKRHGLPGSNNDLNVLRQSQIFNDIWTGKAPDMSFEPMEPPEQQRHHHHSNVWFIKPLSLQSDFLSDCLLSLISPFSSLFSFASAINRVDSTKEPINSAAPPTAVQASTILLRKALLGFLGAAYVCWILTTVMVVSVAVGVALVNIWVEEPVSIKENLYFDYTDVHPYAIVDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035488`
TK1151 ID	TkA04G127400
OH-1004 ID	LXL04_035488
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 76.291 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035488

Location Chr08:23465195-23469852 (+)

Description Similar to SEI1: Seipin-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16460`	Involved in lipid metabolism and lipid droplet (LD) morphology, number, and size.	No verified direct reference in this release
`At1g29760`	Involved in lipid metabolism and lipid droplet (LD) morphology, number, and size.	No verified direct reference in this release
`At2g34380`	Involved in lipid metabolism and lipid droplet (LD) morphology, number, and size.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035488 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0009846 pollen germination Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0010344 seed oilbody biogenesis Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0019915 lipid storage Biological Process

GO:0034389 lipid droplet organization Biological Process

GO:0048316 seed development Biological Process

GO:0050995 negative regulation of lipid catabolic process Biological Process

GO:0080155 regulation of double fertilization forming a zygote and endosperm Biological Process

GO:0120162 positive regulation of cold-induced thermogenesis Biological Process

GO:0140042 lipid droplet formation Biological Process

KEGG gene cross-reference

ath:AT1G29760

ath:AT2G34380

ath:AT5G16460

bta:513558

hsa:26580

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.605

Rank 1 · LXL04_035488 · OH-1004

Nucleus0.222

Rank 2 · LXL04_035488 · OH-1004

Golgi apparatus0.166

Rank 3 · LXL04_035488 · OH-1004

Cytoplasm0.093

Rank 4 · LXL04_035488 · OH-1004

Cell membrane0.080

Rank 5 · LXL04_035488 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04827.21Plant_tran91-123 aa

PF06775.20Seipin218-419 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035488	`PF04827.21`	Plant_tran	91	123	7.1e-06	26.5
LXL04_035488	`PF06775.20`	Seipin	218	419	9.1e-50	170.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFD9`	Arabidopsis thaliana	Seipin-1	40.453%	Swiss-Prot	moderate database homology
`F4I340`	Arabidopsis thaliana	Seipin-2	33.119%	Swiss-Prot	moderate database homology
`Q8L615`	Arabidopsis thaliana	Seipin-3	32.540%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card