LXL04_035456 | RubberDandelionOmics

Gene overview

LXL04_035456

Reference: OH-1004 Chr: Chr08 Coordinates: 22872780-22878505 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3387 bp · LXL04_035456|LXL04_035456|OH1004|cDNA

ATGGACTTAGGAGACATAACATTACTATGCATAACTCGTTGGACCCGGTTTAGAAGATCCACAACCTCCGGTGCAAGGAAACCAAAGGAGGCAGCTTTCAAAGCAGCGTGCCCCATAGTAAAACCTTCATTCCTCAAGCCTACTAGAGGGGAAACCCCTGTTAGATCAACACAAGCATGTTTCCCTCCTATCCatccaaaaactaaaatatcAGCCGGTCTGAGGGTCGATCTTCCTTCCAACGGGTCAGTCAAGAAATT...

CDS

Download CDS FASTA

3387 bp · LXL04_035456|LXL04_035456|OH1004|CDS

ATGGACTTAGGAGACATAACATTACTATGCATAACTCGTTGGACCCGGTTTAGAAGATCCACAACCTCCGGTGCAAGGAAACCAAAGGAGGCAGCTTTCAAAGCAGCGTGCCCCATAGTAAAACCTTCATTCCTCAAGCCTACTAGAGGGGAAACCCCTGTTAGATCAACACAAGCATGTTTCCCTCCTATCCATCCAAAAACTAAAATATCAGCCGGTCTGAGGGTCGATCTTCCTTCCAACGGGTCAGTCAAGAAATT...

Protein

Download Protein FASTA

1128 aa · LXL04_035456|LXL04_035456|OH1004|PROTEIN

MDLGDITLLCITRWTRFRRSTTSGARKPKEAAFKAACPIVKPSFLKPTRGETPVRSTQACFPPIHPKTKISAGLRVDLPSNGSVKKLTDDFFLAEIPARLNTSKRTSLTMSCRDIYVVVSVGTRIRFQLTQMYSTKVTGSGVGGVSVTANRVVGVERWRMEGSPSPTLLRFRHFELNISPLSYSAFAGCSPSHLSWTLPLRFNIRNCSDKKTTISISPTKRGRRTSKNKKTTPGGTRVARTEITSEPVADDNSSEIRGKQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035456`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_035456`
Location	Chr08:22872780-22878505 (-)
Description	Similar to IGHMBP2: DNA-binding protein SMUBP-2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035456` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006412 translation Biological Process GO:0006974 DNA damage response Biological Process GO:1903459 mitotic DNA replication lagging strand elongation Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0016604 nuclear body Cellular Component GO:0033203 DNA helicase A complex Cellular Component
KEGG gene cross-reference	hsa:3508 maua:101836074 rno:29532 spo:2539412 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.606

Rank 1 · LXL04_035456 · OH-1004

Mitochondrion0.343

Rank 2 · LXL04_035456 · OH-1004

Cytoplasm0.105

Rank 3 · LXL04_035456 · OH-1004

Nucleus0.075

Rank 4 · LXL04_035456 · OH-1004

Peroxisome0.035

Rank 5 · LXL04_035456 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13086.13AAA_11654-871 aa

PF13604.13AAA_30654-867 aa

PF00270.36DEAD657-725 aa

PF13245.13AAA_19665-866 aa

PF13087.13AAA_12880-1083 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035456	`PF13086.13`	AAA_11	654	871	3.3e-57	194.9
LXL04_035456	`PF13604.13`	AAA_30	654	867	3.4e-13	50.5
LXL04_035456	`PF00270.36`	DEAD	657	725	6.5e-10	39.7
LXL04_035456	`PF13245.13`	AAA_19	665	866	1.3e-09	39.0
LXL04_035456	`PF13087.13`	AAA_12	880	1083	2.4e-51	174.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card