Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1761 bp · LXL04_035437|LXL04_035437|OH1004|cDNA
ATGGCAAAGACATCCGGTTCAGGACTTTTTAACTTTtctcccttctcttcttcaccctcaccctcaccctCGTCCTCGCCGTCACCGGCTGTTGGTGGTTCCGTTGATCCTCAATCATCCGCACCGAAAGACGAGGCACCCACCACTCCGCGGGTTCGAAATGACAACCCAAGAACAACCTCGTCTGGATTTGATCCGGAGGCACTGGAAAGAGGTGCCAAGGCCCTTAAGGAAATCGCTGCCTCCCCTCAAGCTAAAAA...
1752 bp · LXL04_035437|LXL04_035437|OH1004|CDS
ATGGCAAAGACATCCGGTTCAGGACTTTTTAACTTTTCTCCCTTCTCTTCTTCACCCTCACCCTCACCCTCGTCCTCGCCGTCACCGGCTGTTGGTGGTTCCGTTGATCCTCAATCATCCGCACCGAAAGACGAGGCACCCACCACTCCGCGGGTTCGAAATGACAACCCAAGAACAACCTCGTCTGGATTTGATCCGGAGGCACTGGAAAGAGGTGCCAAGGCCCTTAAGGAAATCGCTGCCTCCCCTCAAGCTAAAAA...
Protein
Download Protein FASTA583 aa · LXL04_035437|LXL04_035437|OH1004|PROTEIN
MAKTSGSGLFNFSPFSSSPSPSPSSSPSPAVGGSVDPQSSAPKDEAPTTPRVRNDNPRTTSSGFDPEALERGAKALKEIAASPQAKKAFELMKKQEETRQTELASKTAEFKAIQAQAETAENEHHRARNQELVKMQEESSIRQEQARRATEEQIQAQRRQTEREKAEIERETIRVRAMAEAEARAHEAKLAEDVNKRMLVERANAEREKWVSAINTTFEHIGGGLRAILTDQNKLVVAVGGVTALAAGIYTTREGARVVW...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_035437 |
|---|---|
| TK1151 ID | TkA04G130930 |
| OH-1004 ID | LXL04_035437 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 97.100 |
| Protein coverage (%) | TK1151 98.009 / OH-1004 75.986Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_035437 |
|---|---|
| Location | Chr08:22465962-22469058 (-) |
| Description | Similar to atad3: ATPase family AAA domain-containing protein 3 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0001558 regulation of cell growth Biological Process GO:0006974 DNA damage response Biological Process GO:0007005 mitochondrion organization Biological Process GO:0140374 antiviral innate immune response Biological Process GO:0140468 HRI-mediated signaling Biological Process GO:1903898 negative regulation of PERK-mediated unfolded protein response Biological Process GO:0005739 mitochondrion Cellular Component GO:0005743 mitochondrial inner membrane Cellular Component GO:0042645 mitochondrial nucleoid Cellular Component GO:0044233 mitochondria-associated endoplasmic reticulum membrane contact site Cellular Component GO:0005524 ATP binding Molecular Function GO:0008270 zinc ion binding Molecular Function |
| KEGG gene cross-reference | cel:CELE_F54B3.3 hsa:55210 xla:398759 xla:734380 xtr:407895 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12037.14ATAD3_N45-121 aaPF12037.14ATAD3_N120-274 aaPF00004.36AAA342-469 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_035437 | PF12037.14 | ATAD3_N | 45 | 121 | 3.7e-87 | 292.7 |
| LXL04_035437 | PF12037.14 | ATAD3_N | 120 | 274 | 3.7e-87 | 292.7 |
| LXL04_035437 | PF00004.36 | AAA | 342 | 469 | 1.2e-25 | 91.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.