LXL04_035351 | RubberDandelionOmics

Gene overview

LXL04_035351

Reference: OH-1004 Chr: Chr08 Coordinates: 20859113-20861004 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1389 bp · LXL04_035351|LXL04_035351|OH1004|cDNA

ATGATATCTACAACTGCAATTGGACTAAGGGCAGCAAACAGCCTCTTGGGTTCATCCTATTTCTACTCAGATACAACTGAAAAACTGTCCATCAATGGTGACCTAGGGTTCACATCTGTCATCACCAAGAACACAATCACTGCAAAGAAATCATCCAATTCCACAAAAGCTTTAAACCAACATGTAGCAACTGCTTCTGATCCTTCAAACTCCATAGACCAATGGATTCAAAGATCTCACCACATGGAAGACAAAACATC...

CDS

Download CDS FASTA

1389 bp · LXL04_035351|LXL04_035351|OH1004|CDS

ATGATATCTACAACTGCAATTGGACTAAGGGCAGCAAACAGCCTCTTGGGTTCATCCTATTTCTACTCAGATACAACTGAAAAACTGTCCATCAATGGTGACCTAGGGTTCACATCTGTCATCACCAAGAACACAATCACTGCAAAGAAATCATCCAATTCCACAAAAGCTTTAAACCAACATGTAGCAACTGCTTCTGATCCTTCAAACTCCATAGACCAATGGATTCAAAGATCTCACCACATGGAAGACAAAACATC...

Protein

Download Protein FASTA

462 aa · LXL04_035351|LXL04_035351|OH1004|PROTEIN

MISTTAIGLRAANSLLGSSYFYSDTTEKLSINGDLGFTSVITKNTITAKKSSNSTKALNQHVATASDPSNSIDQWIQRSHHMEDKTSEQELPDETLLLLQTFLEKQWKLSTKKNTEINSRKVHVTGSQISARKRRISARNKTPNTCPEIGSELLQNQFKGYVNGVRSEALLTQSEVIVLSNKIKIGLRLEEQRSRMKEKLGYEPSEGELATSMRISRMDLRTKQIEFTLAKEKLALSNVRLVMSIAQRYDNMGAQMADLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035351`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035351

Location Chr08:20859113-20861004 (-)

Description Similar to SIGA: RNA polymerase sigma factor sigA

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64860`	Essential protein.	No verified direct reference in this release
`At1g08540`	Required for the transition of plastids into chloroplasts by coordinating nuclear and chloroplastic genomes under light conditions.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0163400`	Sigma factors are initiation factors that promote the attachment of plastid-encoded RNA polymerase (PEP) to specific initiation sites and are then released (Probable).	The plastid sigma factor SIG1 maintains photosystem I activity via regulated expression of the psaA operon in rice chloroplasts.2007 · DOI: 10.1111/j.1365-313x.2007.03216.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035351 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006352 DNA-templated transcription initiation Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006399 tRNA metabolic process Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010114 response to red light Biological Process

GO:0071461 cellular response to redox state Biological Process

GO:0071482 cellular response to light stimulus Biological Process

GO:0080005 photosystem stoichiometry adjustment Biological Process

GO:2001141 regulation of RNA biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:1903865 sigma factor antagonist complex Cellular Component

KEGG gene cross-reference

ana:all5263

ath:AT1G08540

ath:AT1G64860

dosa:Os08g0163400

osa:4344738

syf:Synpcc7942_0672

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.484

Rank 1 · LXL04_035351 · OH-1004

Plastid0.450

Rank 2 · LXL04_035351 · OH-1004

Nucleus0.053

Rank 3 · LXL04_035351 · OH-1004

Cytoplasm0.042

Rank 4 · LXL04_035351 · OH-1004

Cell membrane0.008

Rank 5 · LXL04_035351 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04542.21Sigma70_r2237-298 aa

PF04539.23Sigma70_r3317-362 aa

PF04545.23Sigma70_r4399-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035351	`PF04542.21`	Sigma70_r2	237	298	3.7e-16	59.4
LXL04_035351	`PF04539.23`	Sigma70_r3	317	362	9.4e-10	39.2
LXL04_035351	`PF04545.23`	Sigma70_r4	399	447	1.3e-11	44.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O24629`	Arabidopsis thaliana	RNA polymerase sigma factor sigA	55.754%	Swiss-Prot	strong database homology
`O22056`	Arabidopsis thaliana	RNA polymerase sigma factor sigB	35.430%	Swiss-Prot	moderate database homology
`Q0J7T6`	Oryza sativa subsp. japonica	RNA polymerase sigma factor sigA	53.790%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card