LXL04_035309 | RubberDandelionOmics

Gene overview

LXL04_035309

Reference: OH-1004 Chr: Chr08 Coordinates: 19964122-19966122 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

984 bp · LXL04_035309|LXL04_035309|OH1004|cDNA

ATGCATTCAGACGACCTAAAAGATTTGTCCTTGTATTCAAATGGGGGCCCAAAACCATCGGATTCACTTGTTGTATGCTTTGGGGAAATGTTGATCGATTTTGTGCCGTCAATTGCTGGGGTCTCACTTGCAGAAGCACCCGATTTCAAAAAAGCTCCCGGTGGTGCTCCTGCTAATGTCGCTGTCGGTATATCAAGATTGGGAGGTTCTTCCGCTTTCATAGGCAAGGTGGGTGATGACGAATTTGGTCACATGTTGGC...

CDS

Download CDS FASTA

984 bp · LXL04_035309|LXL04_035309|OH1004|CDS

ATGCATTCAGACGACCTAAAAGATTTGTCCTTGTATTCAAATGGGGGCCCAAAACCATCGGATTCACTTGTTGTATGCTTTGGGGAAATGTTGATCGATTTTGTGCCGTCAATTGCTGGGGTCTCACTTGCAGAAGCACCCGATTTCAAAAAAGCTCCCGGTGGTGCTCCTGCTAATGTCGCTGTCGGTATATCAAGATTGGGAGGTTCTTCCGCTTTCATAGGCAAGGTGGGTGATGACGAATTTGGTCACATGTTGGC...

Protein

Download Protein FASTA

327 aa · LXL04_035309|LXL04_035309|OH1004|PROTEIN

MHSDDLKDLSLYSNGGPKPSDSLVVCFGEMLIDFVPSIAGVSLAEAPDFKKAPGGAPANVAVGISRLGGSSAFIGKVGDDEFGHMLADVLKENKVDNSGMRFDQNARTALAFVTLRSDGEREFMFYRNPSADMLFRESELDLNLIKQASIFHFGSISLIDEPIKSTHLAAMAIAKKSGSILSYDVNLRLPLWPSEDAARQGIMSIWDQADIIKVSEDEITFLTGGDNPYDDKVVLNKLFHQNLKLLLQFRGRVAGVKVKP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035309`
TK1151 ID	TkA04G144060
OH-1004 ID	LXL04_035309
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.200
Protein coverage (%)	TK1151 98.256 / OH-1004 99.388 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035309

Location Chr08:19964122-19966122 (-)

Description Similar to At5g51830: Probable fructokinase-7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51830`	May play an important role in maintaining the flux of carbon towards starch formation.	No verified direct reference in this release
`At1g66430`	May play an important role in maintaining the flux of carbon towards starch formation.	No verified direct reference in this release
`At3g59480`	May play an important role in maintaining the flux of carbon towards starch formation.	No verified direct reference in this release
`At4g10260`	May play an important role in maintaining the flux of carbon towards starch formation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035309 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006000 fructose metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0016051 carbohydrate biosynthetic process Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0008865 fructokinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G66430

ath:AT3G59480

ath:AT4G10260

ath:AT5G51830

sly:544022

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.602

Rank 1 · LXL04_035309 · OH-1004

Nucleus0.263

Rank 2 · LXL04_035309 · OH-1004

Mitochondrion0.134

Rank 3 · LXL04_035309 · OH-1004

Peroxisome0.107

Rank 4 · LXL04_035309 · OH-1004

Plastid0.087

Rank 5 · LXL04_035309 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00294.30PfkB23-237 aa

PF00294.30PfkB253-317 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035309	`PF00294.30`	PfkB	23	237	4.4e-68	230.6
LXL04_035309	`PF00294.30`	PfkB	253	317	4.4e-68	230.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLH8`	Arabidopsis thaliana	Probable fructokinase-7	71.726%	Swiss-Prot	strong database homology
`Q9C524`	Arabidopsis thaliana	Probable fructokinase-6, chloroplastic	67.964%	Swiss-Prot	strong database homology
`Q9M1B9`	Arabidopsis thaliana	Probable fructokinase-4	62.893%	Swiss-Prot	strong database homology
`O82616`	Arabidopsis thaliana	Probable fructokinase-5	63.091%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card