LXL04_035163 | RubberDandelionOmics

Gene overview

LXL04_035163

Reference: OH-1004 Chr: Chr08 Coordinates: 16038966-16041263 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

744 bp · LXL04_035163|LXL04_035163|OH1004|cDNA

ATGCTGATGTTGGGATGTAGAGAAAAGACTGGAGATTATGCTATAAAAGCAAGACTTTTAGCACTTAAGATAATGGGAGCCATAACTGAAAGCCTTGGAATGGGGTCAAAATATCTTGAAAGCAAAATGGAAGATGGGATGCAAGTGATAGCGGTGAATTGCTACCCACAATGTCCTGAACCAAATCTGACATTAGGCTTACCACCTCATTCAGATTATAGCTGCATTACCATAGTTCTTCATAGCTCATGTGGACTTGA...

CDS

Download CDS FASTA

744 bp · LXL04_035163|LXL04_035163|OH1004|CDS

ATGCTGATGTTGGGATGTAGAGAAAAGACTGGAGATTATGCTATAAAAGCAAGACTTTTAGCACTTAAGATAATGGGAGCCATAACTGAAAGCCTTGGAATGGGGTCAAAATATCTTGAAAGCAAAATGGAAGATGGGATGCAAGTGATAGCGGTGAATTGCTACCCACAATGTCCTGAACCAAATCTGACATTAGGCTTACCACCTCATTCAGATTATAGCTGCATTACCATAGTTCTTCATAGCTCATGTGGACTTGA...

Protein

Download Protein FASTA

247 aa · LXL04_035163|LXL04_035163|OH1004|PROTEIN

MLMLGCREKTGDYAIKARLLALKIMGAITESLGMGSKYLESKMEDGMQVIAVNCYPQCPEPNLTLGLPPHSDYSCITIVLHSSCGLEIMDFTDGTWRLVPNLHGALQVHVGDHVEVLSNGLYKSMVHRVTLNNEKTRVSIASLHSMGIDEKMATPEELISNEHPKKYKESSFRDFLNFLSNNDITDGKSFIEFLKINYESWQCDQTGLSNENAPVCMNKMGEDNSRDGDYLMKFKNVKKKRKTIENG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035163`
TK1151 ID	TkA04G161640
OH-1004 ID	LXL04_035163
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	96.300
Protein coverage (%)	TK1151 71.698 / OH-1004 76.923 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035163

Location Chr08:16038966-16041263 (+)

Description Similar to F3H-3: Flavanone 3-dioxygenase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0667200`	Catalyzes the 3-beta-hydroxylation of 2S-flavanones to 2R,3R-dihydroflavonols which are intermediates in the biosynthesis of flavonols, anthocyanidins, catechins and proanthocyanidins in plants.	No verified direct reference in this release
`Os04g0667400`	Involved in melatonin degradation.	No verified direct reference in this release
`Os08g0560000`	Involved in the regulation of shoot development and salicylic acid (SA) homeostasis.	No verified direct reference in this release
`Os09g0570800`	Involved in the regulation of shoot development and salicylic acid (SA) homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035163 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009813 flavonoid biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016706 2-oxoglutarate-dependent dioxygenase activity Molecular Function

GO:0031418 L-ascorbic acid binding Molecular Function

GO:0045486 flavanone 3-dioxygenase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051213 dioxygenase activity Molecular Function

KEGG gene cross-reference

dosa:Os04g0667200

dosa:Os04g0667400

dosa:Os08g0560000

dosa:Os09g0570800

osa:4337325

osa:4337327

osa:4346321

osa:4347916

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.655

Rank 1 · LXL04_035163 · OH-1004

Nucleus0.396

Rank 2 · LXL04_035163 · OH-1004

Endoplasmic reticulum0.059

Rank 3 · LXL04_035163 · OH-1004

Cell membrane0.049

Rank 4 · LXL04_035163 · OH-1004

Mitochondrion0.045

Rank 5 · LXL04_035163 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03171.272OG-FeII_Oxy48-143 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035163	`PF03171.27`	2OG-FeII_Oxy	48	143	3.1e-24	85.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7XR84`	Oryza sativa subsp. japonica	Flavanone 3-dioxygenase 3	45.789%	Swiss-Prot	moderate database homology
`Q7XR83`	Oryza sativa subsp. japonica	2-oxoglutarate-dependent dioxygenase 21, chloroplastic	48.438%	Swiss-Prot	moderate database homology
`Q6YYX9`	Oryza sativa subsp. japonica	Probable 2-oxoglutarate-dependent dioxygenase SLC1	40.860%	Swiss-Prot	moderate database homology
`Q651B6`	Oryza sativa subsp. japonica	Probable 2-oxoglutarate-dependent dioxygenase SLC2	41.111%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card