LXL04_035068 | RubberDandelionOmics

Gene overview

LXL04_035068

Reference: OH-1004 Chr: Chr08 Coordinates: 13310880-13311942 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

648 bp · LXL04_035068|LXL04_035068|OH1004|cDNA

ATGGCATATAGGGTTGATCACGAGTATGATTACCTATTTAAGATCGTGTTAATTGGGGATTCGGGTGTCGGAAAATCCAATATACTTTCTCGGTTTACCCGGAATGAGTTCTGTTTGGAGTCAAAATCCACCATTGGCGTCGAATTTGCTACAAGGACTCTTCAGGTGGAAGGAAAGACGGTGAAAGCACAAATATGGGATACAGCGGGTCAAGAAAGGTATAGAGCAATCACAAGTGCTTATTATAGAGGGGCAGTAGG...

CDS

Download CDS FASTA

648 bp · LXL04_035068|LXL04_035068|OH1004|CDS

ATGGCATATAGGGTTGATCACGAGTATGATTACCTATTTAAGATCGTGTTAATTGGGGATTCGGGTGTCGGAAAATCCAATATACTTTCTCGGTTTACCCGGAATGAGTTCTGTTTGGAGTCAAAATCCACCATTGGCGTCGAATTTGCTACAAGGACTCTTCAGGTGGAAGGAAAGACGGTGAAAGCACAAATATGGGATACAGCGGGTCAAGAAAGGTATAGAGCAATCACAAGTGCTTATTATAGAGGGGCAGTAGG...

Protein

Download Protein FASTA

215 aa · LXL04_035068|LXL04_035068|OH1004|PROTEIN

MAYRVDHEYDYLFKIVLIGDSGVGKSNILSRFTRNEFCLESKSTIGVEFATRTLQVEGKTVKAQIWDTAGQERYRAITSAYYRGAVGALLVYDITKRQSFENVQRWLRELRDHADSNIVIMLAGNKSDLNHLRAVLETDGQGFAEKEGLSFLETSALEAHNVEKAFQMILLDIYQIISRKALAAQEAAAAVPTQGTTINVGDYNNNGKQKGCCSH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035068`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035068

Location Chr08:13310880-13311942 (-)

Description Similar to RAB11C: Ras-related protein Rab11C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07410`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At3g46830`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At5g59150`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035068 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009504 cell plate Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0003924 GTPase activity Molecular Function

KEGG gene cross-reference

ath:AT1G07410

ath:AT3G46830

ath:AT5G59150

bvg:104900042

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.509

Rank 1 · LXL04_035068 · OH-1004

Golgi apparatus0.426

Rank 2 · LXL04_035068 · OH-1004

Cell membrane0.200

Rank 3 · LXL04_035068 · OH-1004

Lysosome / Vacuole0.192

Rank 4 · LXL04_035068 · OH-1004

Endoplasmic reticulum0.137

Rank 5 · LXL04_035068 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00025.28Arf13-133 aa

PF00071.29Ras14-174 aa

PF08477.20Roc14-128 aa

PF01926.30MMR_HSR114-121 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035068	`PF00025.28`	Arf	13	133	1.2e-13	51.7
LXL04_035068	`PF00071.29`	Ras	14	174	1.6e-62	210.6
LXL04_035068	`PF08477.20`	Roc	14	128	2.7e-35	121.9
LXL04_035068	`PF01926.30`	MMR_HSR1	14	121	2.1e-06	28.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNW1`	Arabidopsis thaliana	Ras-related protein RABA2b	84.579%	Swiss-Prot	strong database homology
`Q96283`	Arabidopsis thaliana	Ras-related protein RABA2c	81.567%	Swiss-Prot	strong database homology
`Q9FIF9`	Arabidopsis thaliana	Ras-related protein RABA2d	81.106%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card